\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0218810920:

Variant ID: vg0218810920 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 18810920
Reference Allele: CAlternative Allele: G
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGTGGGGCTCACCCTATTTTTTTTATAAATAAATTGCTGACTGGACTGTCACGTAGGATCAAAATCACTGCGGATTGAGCCGGGGGGTGGAGGGTGGGGG[C/G]
TATTTGTCTGATTTACAAAGTTGAGGGTGAAGGATGTCCAATTTTGTGATTCAGGGGGTAATTCAGTCTACCGTGATTGTCCAGGGGGTAATTTATACCT

Reverse complement sequence

AGGTATAAATTACCCCCTGGACAATCACGGTAGACTGAATTACCCCCTGAATCACAAAATTGGACATCCTTCACCCTCAACTTTGTAAATCAGACAAATA[G/C]
CCCCCACCCTCCACCCCCCGGCTCAATCCGCAGTGATTTTGATCCTACGTGACAGTCCAGTCAGCAATTTATTTATAAAAAAAATAGGGTGAGCCCCACC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.90% 49.10% 0.85% 0.19% NA
All Indica  2759 78.70% 19.80% 1.27% 0.25% NA
All Japonica  1512 2.20% 97.70% 0.07% 0.07% NA
Aus  269 43.90% 55.00% 0.74% 0.37% NA
Indica I  595 77.60% 19.50% 2.86% 0.00% NA
Indica II  465 61.70% 36.30% 1.08% 0.86% NA
Indica III  913 84.80% 15.00% 0.22% 0.00% NA
Indica Intermediate  786 82.40% 15.80% 1.40% 0.38% NA
Temperate Japonica  767 1.40% 98.30% 0.13% 0.13% NA
Tropical Japonica  504 1.80% 98.20% 0.00% 0.00% NA
Japonica Intermediate  241 5.40% 94.60% 0.00% 0.00% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 35.60% 62.20% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0218810920 C -> G LOC_Os02g31840.1 upstream_gene_variant ; 4331.0bp to feature; MODIFIER silent_mutation Average:59.141; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N
vg0218810920 C -> G LOC_Os02g31845.1 upstream_gene_variant ; 914.0bp to feature; MODIFIER silent_mutation Average:59.141; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N
vg0218810920 C -> G LOC_Os02g31850.1 upstream_gene_variant ; 2154.0bp to feature; MODIFIER silent_mutation Average:59.141; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N
vg0218810920 C -> G LOC_Os02g31840-LOC_Os02g31845 intergenic_region ; MODIFIER silent_mutation Average:59.141; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N
vg0218810920 C -> DEL N N silent_mutation Average:59.141; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0218810920 NA 5.28E-11 mr1070 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218810920 NA 4.87E-06 mr1255 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218810920 3.45E-06 1.03E-11 mr1317 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218810920 3.25E-07 2.84E-14 mr1317 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218810920 NA 4.92E-06 mr1585 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218810920 NA 5.48E-06 mr1818 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218810920 NA 9.83E-06 mr1832 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218810920 4.70E-07 1.17E-24 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218810920 NA 4.66E-06 mr1897 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218810920 NA 1.18E-12 mr1914 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218810920 NA 4.02E-08 mr1914 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218810920 NA 1.34E-06 mr1927 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218810920 NA 3.43E-08 mr1109_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218810920 9.88E-06 2.30E-09 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218810920 NA 5.68E-06 mr1253_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218810920 NA 3.43E-20 mr1255_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218810920 1.51E-06 4.37E-08 mr1255_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218810920 NA 5.18E-08 mr1257_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218810920 NA 8.48E-10 mr1317_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218810920 1.15E-06 1.80E-15 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218810920 NA 1.34E-11 mr1377_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218810920 NA 3.18E-07 mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218810920 5.78E-07 4.57E-12 mr1610_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218810920 6.34E-07 1.20E-13 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218810920 2.13E-06 3.27E-24 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218810920 4.35E-08 1.78E-16 mr1897_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218810920 5.84E-06 2.72E-17 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218810920 6.29E-08 3.97E-18 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251