\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0218796566:

Variant ID: vg0218796566 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 18796566
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.88, T: 0.11, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


AGCACCACCAAACGGAAGAAGAAAATGCTTATTACATGCATGATAAAATAATTAAAAACTCTTTCAACAGTCATACAATAATGACATATCATTATTCATA[C/T]
AATAATTATAAAATAATCCAACAAACATTTCATATTTATTGTTTTTAAAGTTTTAAACTAATATTAATGTTGTACTTCTTTTAATTTTTAATTTAGTTTG

Reverse complement sequence

CAAACTAAATTAAAAATTAAAAGAAGTACAACATTAATATTAGTTTAAAACTTTAAAAACAATAAATATGAAATGTTTGTTGGATTATTTTATAATTATT[G/A]
TATGAATAATGATATGTCATTATTGTATGACTGTTGAAAGAGTTTTTAATTATTTTATCATGCATGTAATAAGCATTTTCTTCTTCCGTTTGGTGGTGCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.80% 48.60% 0.57% 0.00% NA
All Indica  2759 22.80% 76.40% 0.80% 0.00% NA
All Japonica  1512 97.70% 2.20% 0.13% 0.00% NA
Aus  269 54.30% 45.40% 0.37% 0.00% NA
Indica I  595 19.30% 80.50% 0.17% 0.00% NA
Indica II  465 35.90% 62.40% 1.72% 0.00% NA
Indica III  913 24.40% 75.00% 0.55% 0.00% NA
Indica Intermediate  786 15.80% 83.20% 1.02% 0.00% NA
Temperate Japonica  767 98.30% 1.70% 0.00% 0.00% NA
Tropical Japonica  504 98.20% 1.80% 0.00% 0.00% NA
Japonica Intermediate  241 94.60% 4.60% 0.83% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 65.60% 32.20% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0218796566 C -> T LOC_Os02g31320.1 downstream_gene_variant ; 3778.0bp to feature; MODIFIER silent_mutation Average:31.317; most accessible tissue: Zhenshan97 root, score: 47.644 N N N N
vg0218796566 C -> T LOC_Os02g31330.1 downstream_gene_variant ; 1508.0bp to feature; MODIFIER silent_mutation Average:31.317; most accessible tissue: Zhenshan97 root, score: 47.644 N N N N
vg0218796566 C -> T LOC_Os02g31830.1 downstream_gene_variant ; 392.0bp to feature; MODIFIER silent_mutation Average:31.317; most accessible tissue: Zhenshan97 root, score: 47.644 N N N N
vg0218796566 C -> T LOC_Os02g31330-LOC_Os02g31830 intergenic_region ; MODIFIER silent_mutation Average:31.317; most accessible tissue: Zhenshan97 root, score: 47.644 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0218796566 NA 1.73E-06 mr1109 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218796566 NA 1.86E-10 mr1317 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218796566 7.45E-06 1.33E-09 mr1317 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218796566 NA 7.05E-06 mr1585 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218796566 NA 1.20E-07 mr1610 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218796566 NA 4.31E-06 mr1832 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218796566 NA 1.71E-16 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218796566 NA 7.21E-08 mr1093_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218796566 NA 6.41E-09 mr1109_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218796566 NA 3.46E-09 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218796566 NA 1.55E-19 mr1255_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218796566 NA 2.09E-07 mr1255_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218796566 NA 6.18E-09 mr1257_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218796566 NA 1.42E-10 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218796566 NA 6.10E-12 mr1377_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218796566 NA 2.72E-08 mr1599_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218796566 2.75E-06 NA mr1610_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218796566 8.81E-07 5.34E-13 mr1610_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218796566 NA 5.84E-09 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218796566 1.57E-06 3.15E-16 mr1855_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218796566 NA 2.45E-10 mr1897_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218796566 NA 5.58E-14 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218796566 NA 5.48E-14 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251