\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0218790628:

Variant ID: vg0218790628 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 18790628
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.74, T: 0.26, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:


TTTGCAAAGCACTACGATACAAGATAAGACGAGATGATCCAGGTGAAGTTGACGGACAACCTTTGAAGAAGAGAATTCCTGCTAAGGTGATGTGGTATTT[T/C]
CCTATAATACCAAGGCTGAAGCGGTTTTTCAGGAACAAATCACAAGCTAGAATGATACGGTGGCACGCAGAAGAACGTAAACAGGATGGGATGCTGAGAC

Reverse complement sequence

GTCTCAGCATCCCATCCTGTTTACGTTCTTCTGCGTGCCACCGTATCATTCTAGCTTGTGATTTGTTCCTGAAAAACCGCTTCAGCCTTGGTATTATAGG[A/G]
AAATACCACATCACCTTAGCAGGAATTCTCTTCTTCAAAGGTTGTCCGTCAACTTCACCTGGATCATCTCGTCTTATCTTGTATCGTAGTGCTTTGCAAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.30% 0.10% 26.39% 13.22% NA
All Indica  2759 42.00% 0.20% 36.17% 21.60% NA
All Japonica  1512 89.70% 0.00% 9.66% 0.66% NA
Aus  269 68.40% 0.00% 27.14% 4.46% NA
Indica I  595 50.90% 0.20% 31.09% 17.82% NA
Indica II  465 39.60% 0.40% 38.06% 21.94% NA
Indica III  913 38.40% 0.10% 38.44% 23.00% NA
Indica Intermediate  786 40.80% 0.30% 36.26% 22.65% NA
Temperate Japonica  767 98.20% 0.00% 1.43% 0.39% NA
Tropical Japonica  504 80.20% 0.00% 18.65% 1.19% NA
Japonica Intermediate  241 82.60% 0.00% 17.01% 0.41% NA
VI/Aromatic  96 86.50% 0.00% 13.54% 0.00% NA
Intermediate  90 73.30% 0.00% 18.89% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0218790628 T -> DEL LOC_Os02g31320.1 N frameshift_variant Average:22.12; most accessible tissue: Zhenshan97 flag leaf, score: 35.167 N N N N
vg0218790628 T -> C LOC_Os02g31320.1 synonymous_variant ; p.Phe275Phe; LOW synonymous_codon Average:22.12; most accessible tissue: Zhenshan97 flag leaf, score: 35.167 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0218790628 1.76E-06 3.73E-13 mr1317 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218790628 1.89E-07 2.47E-15 mr1317 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218790628 NA 4.52E-06 mr1818 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218790628 NA 6.70E-06 mr1832 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218790628 2.74E-06 5.99E-21 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218790628 NA 1.93E-07 mr1897 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218790628 NA 2.38E-12 mr1914 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218790628 NA 6.74E-07 mr1914 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218790628 NA 1.09E-06 mr1927 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218790628 NA 2.19E-07 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218790628 NA 1.00E-13 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218790628 NA 2.94E-06 mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218790628 4.14E-06 2.48E-11 mr1610_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218790628 7.97E-06 7.72E-12 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218790628 NA 4.79E-22 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218790628 3.14E-06 8.26E-15 mr1897_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218790628 NA 4.93E-15 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218790628 NA 2.06E-15 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251