\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0218736301:

Variant ID: vg0218736301 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 18736301
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, T: 0.01, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:


TTGTGTGTGATGTGAATATGTGATGTATTTGATTTGTGTGTGATGTGAATATGTGATGTATTTGTGATGAATTTTGTAGAAGTTGTAATGTAATTTTTTA[A/T]
GATTTTGTGATGTATTTAGAGATATTGATTTGAGAATTTGGAGACTATTCGGGGATGATTGATTTGGGATTTTGGGATAGGATAGAGTGAATCAATATAT

Reverse complement sequence

ATATATTGATTCACTCTATCCTATCCCAAAATCCCAAATCAATCATCCCCGAATAGTCTCCAAATTCTCAAATCAATATCTCTAAATACATCACAAAATC[T/A]
TAAAAAATTACATTACAACTTCTACAAAATTCATCACAAATACATCACATATTCACATCACACACAAATCAAATACATCACATATTCACATCACACACAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.80% 37.90% 0.36% 0.00% NA
All Indica  2759 39.90% 59.60% 0.51% 0.00% NA
All Japonica  1512 98.10% 1.90% 0.00% 0.00% NA
Aus  269 68.00% 32.00% 0.00% 0.00% NA
Indica I  595 58.70% 40.80% 0.50% 0.00% NA
Indica II  465 38.30% 61.50% 0.22% 0.00% NA
Indica III  913 33.60% 66.00% 0.33% 0.00% NA
Indica Intermediate  786 33.80% 65.30% 0.89% 0.00% NA
Temperate Japonica  767 98.30% 1.70% 0.00% 0.00% NA
Tropical Japonica  504 98.20% 1.80% 0.00% 0.00% NA
Japonica Intermediate  241 97.10% 2.90% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 64.40% 32.20% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0218736301 A -> T LOC_Os02g31240-LOC_Os02g31270 intergenic_region ; MODIFIER silent_mutation Average:37.077; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0218736301 NA 8.10E-06 mr1255 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218736301 NA 1.13E-07 mr1093_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218736301 NA 2.87E-08 mr1109_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218736301 NA 9.37E-10 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218736301 NA 5.48E-09 mr1251_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218736301 NA 9.73E-24 mr1255_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218736301 NA 1.15E-09 mr1255_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218736301 NA 1.66E-10 mr1257_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218736301 NA 1.28E-16 mr1377_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218736301 NA 4.65E-07 mr1377_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218736301 NA 6.94E-06 mr1423_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218736301 NA 6.57E-09 mr1435_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218736301 NA 3.38E-06 mr1577_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218736301 NA 1.53E-08 mr1599_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251