\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0218685673:

Variant ID: vg0218685673 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 18685673
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.00, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:


ACAAAGAAACCATATTCCGAGACCAAGCTATCTCCAACTTGACTCATTAGTAGCAAACAGTAGTATTACATACGTATAGTATCCATCTAGAAGTCATAAT[C/T]
ATGAAATAATCACGGATATCCAAACAAACAACCCGAAACCGAAACTGACACAGCGTCGGCCGGTCAGACCGCGGGCTGCGCCGGTCTGACCGCGCATTAC

Reverse complement sequence

GTAATGCGCGGTCAGACCGGCGCAGCCCGCGGTCTGACCGGCCGACGCTGTGTCAGTTTCGGTTTCGGGTTGTTTGTTTGGATATCCGTGATTATTTCAT[G/A]
ATTATGACTTCTAGATGGATACTATACGTATGTAATACTACTGTTTGCTACTAATGAGTCAAGTTGGAGATAGCTTGGTCTCGGAATATGGTTTCTTTGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.10% 5.80% 3.30% 1.80% NA
All Indica  2759 91.20% 3.30% 3.62% 1.88% NA
All Japonica  1512 83.50% 11.20% 3.37% 1.92% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 90.80% 2.80% 4.09% 2.37% NA
Indica III  913 81.20% 7.20% 7.45% 4.16% NA
Indica Intermediate  786 96.30% 1.70% 1.65% 0.38% NA
Temperate Japonica  767 99.10% 0.90% 0.00% 0.00% NA
Tropical Japonica  504 67.50% 21.60% 6.55% 4.37% NA
Japonica Intermediate  241 67.60% 22.00% 7.47% 2.90% NA
VI/Aromatic  96 86.50% 9.40% 3.12% 1.04% NA
Intermediate  90 91.10% 3.30% 2.22% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0218685673 C -> T LOC_Os02g31190.1 upstream_gene_variant ; 1429.0bp to feature; MODIFIER silent_mutation Average:57.593; most accessible tissue: Minghui63 root, score: 77.009 N N N N
vg0218685673 C -> T LOC_Os02g31190-LOC_Os02g31200 intergenic_region ; MODIFIER silent_mutation Average:57.593; most accessible tissue: Minghui63 root, score: 77.009 N N N N
vg0218685673 C -> DEL N N silent_mutation Average:57.593; most accessible tissue: Minghui63 root, score: 77.009 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0218685673 8.89E-06 4.12E-07 mr1050 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218685673 NA 2.47E-09 mr1093 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218685673 5.02E-08 4.66E-10 mr1272 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218685673 NA 2.62E-06 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218685673 NA 5.54E-08 mr1089_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218685673 NA 2.12E-10 mr1093_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218685673 NA 3.17E-06 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218685673 NA 3.41E-06 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218685673 NA 1.99E-06 mr1138_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218685673 NA 1.48E-12 mr1178_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218685673 NA 3.44E-08 mr1235_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218685673 NA 8.30E-06 mr1258_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218685673 NA 1.20E-06 mr1552_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218685673 NA 5.41E-08 mr1599_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251