\
| Variant ID: vg0218685673 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 18685673 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.00, others allele: 0.00, population size: 281. )
ACAAAGAAACCATATTCCGAGACCAAGCTATCTCCAACTTGACTCATTAGTAGCAAACAGTAGTATTACATACGTATAGTATCCATCTAGAAGTCATAAT[C/T]
ATGAAATAATCACGGATATCCAAACAAACAACCCGAAACCGAAACTGACACAGCGTCGGCCGGTCAGACCGCGGGCTGCGCCGGTCTGACCGCGCATTAC
GTAATGCGCGGTCAGACCGGCGCAGCCCGCGGTCTGACCGGCCGACGCTGTGTCAGTTTCGGTTTCGGGTTGTTTGTTTGGATATCCGTGATTATTTCAT[G/A]
ATTATGACTTCTAGATGGATACTATACGTATGTAATACTACTGTTTGCTACTAATGAGTCAAGTTGGAGATAGCTTGGTCTCGGAATATGGTTTCTTTGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.10% | 5.80% | 3.30% | 1.80% | NA |
| All Indica | 2759 | 91.20% | 3.30% | 3.62% | 1.88% | NA |
| All Japonica | 1512 | 83.50% | 11.20% | 3.37% | 1.92% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 90.80% | 2.80% | 4.09% | 2.37% | NA |
| Indica III | 913 | 81.20% | 7.20% | 7.45% | 4.16% | NA |
| Indica Intermediate | 786 | 96.30% | 1.70% | 1.65% | 0.38% | NA |
| Temperate Japonica | 767 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 67.50% | 21.60% | 6.55% | 4.37% | NA |
| Japonica Intermediate | 241 | 67.60% | 22.00% | 7.47% | 2.90% | NA |
| VI/Aromatic | 96 | 86.50% | 9.40% | 3.12% | 1.04% | NA |
| Intermediate | 90 | 91.10% | 3.30% | 2.22% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0218685673 | C -> T | LOC_Os02g31190.1 | upstream_gene_variant ; 1429.0bp to feature; MODIFIER | silent_mutation | Average:57.593; most accessible tissue: Minghui63 root, score: 77.009 | N | N | N | N |
| vg0218685673 | C -> T | LOC_Os02g31190-LOC_Os02g31200 | intergenic_region ; MODIFIER | silent_mutation | Average:57.593; most accessible tissue: Minghui63 root, score: 77.009 | N | N | N | N |
| vg0218685673 | C -> DEL | N | N | silent_mutation | Average:57.593; most accessible tissue: Minghui63 root, score: 77.009 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0218685673 | 8.89E-06 | 4.12E-07 | mr1050 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218685673 | NA | 2.47E-09 | mr1093 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218685673 | 5.02E-08 | 4.66E-10 | mr1272 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218685673 | NA | 2.62E-06 | mr1408 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218685673 | NA | 5.54E-08 | mr1089_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218685673 | NA | 2.12E-10 | mr1093_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218685673 | NA | 3.17E-06 | mr1113_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218685673 | NA | 3.41E-06 | mr1114_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218685673 | NA | 1.99E-06 | mr1138_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218685673 | NA | 1.48E-12 | mr1178_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218685673 | NA | 3.44E-08 | mr1235_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218685673 | NA | 8.30E-06 | mr1258_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218685673 | NA | 1.20E-06 | mr1552_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218685673 | NA | 5.41E-08 | mr1599_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |