\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0218680006:

Variant ID: vg0218680006 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 18680006
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACCAATGATTTGTTCCGGCGGATGTCGTCGTTGAATGTGCAAAGGAGCATCTCGAACAACATCAACAGAACCCTCAGCCGACGACCCTGGCCGGTCTGCC[C/T]
GCACCTCCTGTGCCGGTCTGACCGGAGGTGTGACGGTGGTCTGACCGGCCTGGCGCCCGGTCTGACCAGCCGAGCCGACCTCCTCGTCGTCGTTGTCGTC

Reverse complement sequence

GACGACAACGACGACGAGGAGGTCGGCTCGGCTGGTCAGACCGGGCGCCAGGCCGGTCAGACCACCGTCACACCTCCGGTCAGACCGGCACAGGAGGTGC[G/A]
GGCAGACCGGCCAGGGTCGTCGGCTGAGGGTTCTGTTGATGTTGTTCGAGATGCTCCTTTGCACATTCAACGACGACATCCGCCGGAACAAATCATTGGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.70% 18.40% 0.85% 0.00% NA
All Indica  2759 91.60% 7.40% 1.01% 0.00% NA
All Japonica  1512 60.30% 39.60% 0.20% 0.00% NA
Aus  269 84.40% 12.30% 3.35% 0.00% NA
Indica I  595 97.00% 1.00% 2.02% 0.00% NA
Indica II  465 78.90% 20.20% 0.86% 0.00% NA
Indica III  913 93.10% 6.40% 0.55% 0.00% NA
Indica Intermediate  786 93.40% 5.70% 0.89% 0.00% NA
Temperate Japonica  767 28.80% 70.80% 0.39% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 77.20% 22.80% 0.00% 0.00% NA
VI/Aromatic  96 69.80% 30.20% 0.00% 0.00% NA
Intermediate  90 91.10% 8.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0218680006 C -> T LOC_Os02g31190.1 missense_variant ; p.Arg805Gln; MODERATE nonsynonymous_codon ; R805Q Average:44.935; most accessible tissue: Minghui63 young leaf, score: 66.656 possibly damaging 1.699 TOLERATED 0.37

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0218680006 NA 3.62E-12 mr1317 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218680006 9.15E-08 1.96E-08 mr1585 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218680006 NA 1.45E-07 mr1818 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218680006 NA 3.82E-18 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218680006 NA 1.59E-06 mr1927 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218680006 NA 5.93E-07 mr1250_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218680006 NA 1.30E-10 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218680006 NA 2.29E-06 mr1610_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218680006 NA 4.53E-09 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218680006 NA 1.02E-17 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218680006 NA 2.62E-09 mr1897_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218680006 NA 1.71E-11 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218680006 NA 1.41E-10 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251