Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0218680006:

Variant ID: vg0218680006 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 18680006
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACCAATGATTTGTTCCGGCGGATGTCGTCGTTGAATGTGCAAAGGAGCATCTCGAACAACATCAACAGAACCCTCAGCCGACGACCCTGGCCGGTCTGCC[C/T]
GCACCTCCTGTGCCGGTCTGACCGGAGGTGTGACGGTGGTCTGACCGGCCTGGCGCCCGGTCTGACCAGCCGAGCCGACCTCCTCGTCGTCGTTGTCGTC

Reverse complement sequence

GACGACAACGACGACGAGGAGGTCGGCTCGGCTGGTCAGACCGGGCGCCAGGCCGGTCAGACCACCGTCACACCTCCGGTCAGACCGGCACAGGAGGTGC[G/A]
GGCAGACCGGCCAGGGTCGTCGGCTGAGGGTTCTGTTGATGTTGTTCGAGATGCTCCTTTGCACATTCAACGACGACATCCGCCGGAACAAATCATTGGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.70%	18.40%	0.85%	0.00%	NA
All Indica	2759	91.60%	7.40%	1.01%	0.00%	NA
All Japonica	1512	60.30%	39.60%	0.20%	0.00%	NA
Aus	269	84.40%	12.30%	3.35%	0.00%	NA
Indica I	595	97.00%	1.00%	2.02%	0.00%	NA
Indica II	465	78.90%	20.20%	0.86%	0.00%	NA
Indica III	913	93.10%	6.40%	0.55%	0.00%	NA
Indica Intermediate	786	93.40%	5.70%	0.89%	0.00%	NA
Temperate Japonica	767	28.80%	70.80%	0.39%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	77.20%	22.80%	0.00%	0.00%	NA
VI/Aromatic	96	69.80%	30.20%	0.00%	0.00%	NA
Intermediate	90	91.10%	8.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0218680006	C -> T	LOC_Os02g31190.1	missense_variant ; p.Arg805Gln; MODERATE	nonsynonymous_codon ; R805Q	Average:44.935; most accessible tissue: Minghui63 young leaf, score: 66.656	possibly damaging	1.699	TOLERATED	0.37

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0218680006	NA	3.62E-12	mr1317	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218680006	9.15E-08	1.96E-08	mr1585	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218680006	NA	1.45E-07	mr1818	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218680006	NA	3.82E-18	mr1855	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218680006	NA	1.59E-06	mr1927	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218680006	NA	5.93E-07	mr1250_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218680006	NA	1.30E-10	mr1317_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218680006	NA	2.29E-06	mr1610_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218680006	NA	4.53E-09	mr1818_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218680006	NA	1.02E-17	mr1855_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218680006	NA	2.62E-09	mr1897_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218680006	NA	1.71E-11	mr1914_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218680006	NA	1.41E-10	mr1927_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251