\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0218664196:

Variant ID: vg0218664196 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 18664196
Reference Allele: AGGTCCCAAAACAlternative Allele: GGGTCCCAAAAC,AGGGGTCCCAAAAC,A,AGAGGGGTCCCAAAAC
Primary Allele: AGGTCCCAAAACSecondary Allele: GGGTCCCAAAAC

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAAGGAGAGAAGTAAATAAAACGGCGGCAAATCAAAAGGTTGTGGGAGATTTGGGCATGATCCTAAGAGGATATCGCCCATAGAGAGAGAGAGAGAGAG[AGGTCCCAAAAC/GGGTCCCAAAAC,AGGGGTCCCAAAAC,A,AGAGGGGTCCCAAAAC]
GAGAGGCGTGGCTCTTCCATTGTTCCATGCACCTCGCTTGCTTGCTTGCTCGCTCGCTCGCTCGAGCCTCCTGTAACTTTCAGTGTCAACTTCCCCTTTT

Reverse complement sequence

AAAAGGGGAAGTTGACACTGAAAGTTACAGGAGGCTCGAGCGAGCGAGCGAGCAAGCAAGCAAGCGAGGTGCATGGAACAATGGAAGAGCCACGCCTCTC[GTTTTGGGACCT/GTTTTGGGACCC,GTTTTGGGACCCCT,T,GTTTTGGGACCCCTCT]
CTCTCTCTCTCTCTCTCTATGGGCGATATCCTCTTAGGATCATGCCCAAATCTCCCACAACCTTTTGATTTGCCGCCGTTTTATTTACTTCTCTCCTTTT

Allele Frequencies:

Populations Population SizeFrequency of AGGTCCCAAAAC(primary allele) Frequency of GGGTCCCAAAAC(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.10% 7.90% 0.08% 0.00% AGGGGTCCCAAAAC: 0.91%; A: 0.04%; AGAGGGGTCCCAAAAC: 0.02%
All Indica  2759 90.80% 9.00% 0.07% 0.00% A: 0.07%
All Japonica  1512 90.30% 6.70% 0.13% 0.00% AGGGGTCCCAAAAC: 2.78%; AGAGGGGTCCCAAAAC: 0.07%
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.00% 0.00% 0.00% A: 0.17%
Indica II  465 90.50% 9.50% 0.00% 0.00% NA
Indica III  913 80.50% 19.30% 0.11% 0.00% A: 0.11%
Indica Intermediate  786 96.20% 3.70% 0.13% 0.00% NA
Temperate Japonica  767 99.90% 0.00% 0.00% 0.00% AGGGGTCCCAAAAC: 0.13%
Tropical Japonica  504 74.40% 17.70% 0.40% 0.00% AGGGGTCCCAAAAC: 7.34%; AGAGGGGTCCCAAAAC: 0.20%
Japonica Intermediate  241 93.40% 5.00% 0.00% 0.00% AGGGGTCCCAAAAC: 1.66%
VI/Aromatic  96 85.40% 14.60% 0.00% 0.00% NA
Intermediate  90 91.10% 7.80% 0.00% 0.00% AGGGGTCCCAAAAC: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0218664196 AGGTCCCAAAAC -> A LOC_Os02g31160.1 upstream_gene_variant ; 2360.0bp to feature; MODIFIER silent_mutation Average:93.98; most accessible tissue: Zhenshan97 young leaf, score: 99.108 N N N N
vg0218664196 AGGTCCCAAAAC -> A LOC_Os02g31170.1 upstream_gene_variant ; 2697.0bp to feature; MODIFIER silent_mutation Average:93.98; most accessible tissue: Zhenshan97 young leaf, score: 99.108 N N N N
vg0218664196 AGGTCCCAAAAC -> A LOC_Os02g31160-LOC_Os02g31170 intergenic_region ; MODIFIER silent_mutation Average:93.98; most accessible tissue: Zhenshan97 young leaf, score: 99.108 N N N N
vg0218664196 AGGTCCCAAAAC -> AGAGGGGTCCCAAAAC LOC_Os02g31160.1 upstream_gene_variant ; 2361.0bp to feature; MODIFIER silent_mutation Average:93.98; most accessible tissue: Zhenshan97 young leaf, score: 99.108 N N N N
vg0218664196 AGGTCCCAAAAC -> AGAGGGGTCCCAAAAC LOC_Os02g31170.1 upstream_gene_variant ; 2696.0bp to feature; MODIFIER silent_mutation Average:93.98; most accessible tissue: Zhenshan97 young leaf, score: 99.108 N N N N
vg0218664196 AGGTCCCAAAAC -> AGAGGGGTCCCAAAAC LOC_Os02g31160-LOC_Os02g31170 intergenic_region ; MODIFIER silent_mutation Average:93.98; most accessible tissue: Zhenshan97 young leaf, score: 99.108 N N N N
vg0218664196 AGGTCCCAAAAC -> AGGGGTCCCAAAAC LOC_Os02g31160.1 upstream_gene_variant ; 2362.0bp to feature; MODIFIER silent_mutation Average:93.98; most accessible tissue: Zhenshan97 young leaf, score: 99.108 N N N N
vg0218664196 AGGTCCCAAAAC -> AGGGGTCCCAAAAC LOC_Os02g31170.1 upstream_gene_variant ; 2695.0bp to feature; MODIFIER silent_mutation Average:93.98; most accessible tissue: Zhenshan97 young leaf, score: 99.108 N N N N
vg0218664196 AGGTCCCAAAAC -> AGGGGTCCCAAAAC LOC_Os02g31160-LOC_Os02g31170 intergenic_region ; MODIFIER silent_mutation Average:93.98; most accessible tissue: Zhenshan97 young leaf, score: 99.108 N N N N
vg0218664196 AGGTCCCAAAAC -> GGGTCCCAAAAC LOC_Os02g31160.1 upstream_gene_variant ; 2359.0bp to feature; MODIFIER silent_mutation Average:93.98; most accessible tissue: Zhenshan97 young leaf, score: 99.108 N N N N
vg0218664196 AGGTCCCAAAAC -> GGGTCCCAAAAC LOC_Os02g31170.1 upstream_gene_variant ; 2698.0bp to feature; MODIFIER silent_mutation Average:93.98; most accessible tissue: Zhenshan97 young leaf, score: 99.108 N N N N
vg0218664196 AGGTCCCAAAAC -> GGGTCCCAAAAC LOC_Os02g31160-LOC_Os02g31170 intergenic_region ; MODIFIER silent_mutation Average:93.98; most accessible tissue: Zhenshan97 young leaf, score: 99.108 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0218664196 AGGTC* A 0.18 0.32 0.2 0.02 0.06 -0.08
vg0218664196 AGGTC* AGAGG* 0.33 0.32 0.28 0.07 0.14 0.07
vg0218664196 AGGTC* AGGGG* 0.04 -0.01 -0.09 -0.04 0.01 -0.03
vg0218664196 AGGTC* GGGTC* 0.04 0.01 0.0 0.04 0.03 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0218664196 NA 6.35E-06 mr1050 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218664196 3.03E-06 NA mr1093 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218664196 NA 1.54E-09 mr1093 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218664196 NA 3.45E-06 mr1119 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218664196 2.91E-07 5.67E-09 mr1272 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218664196 NA 4.81E-07 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218664196 NA 1.25E-08 mr1089_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218664196 NA 2.00E-11 mr1093_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218664196 NA 2.00E-06 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218664196 NA 2.29E-06 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218664196 NA 1.11E-06 mr1138_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218664196 NA 2.27E-14 mr1178_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218664196 NA 1.91E-09 mr1235_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218664196 NA 3.11E-06 mr1258_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218664196 NA 1.88E-07 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218664196 NA 4.25E-06 mr1482_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218664196 1.55E-06 NA mr1552_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218664196 7.84E-06 7.53E-07 mr1552_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218664196 NA 1.46E-08 mr1599_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251