Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0218613608:

Variant ID: vg0218613608 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 18613608
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:

GGGGTGTTTGTGGTTGAAGGCTGTGGATTTCCTCTAGGGTTTTTGCACAAGTAAGGCAAGGGGTTAATTGAGACCTAGCTCTTTGGAGCTCCTCAACAGA[G/T]
AGTAGGATCGCAAGATCCAAACTTCAGGAAAAAAACCGCTCTTGTCTCTTTCTGTGATGTTTCTATGGATGATTCTGTGATATATCTCCTGCTTAGAATA

Reverse complement sequence

TATTCTAAGCAGGAGATATATCACAGAATCATCCATAGAAACATCACAGAAAGAGACAAGAGCGGTTTTTTTCCTGAAGTTTGGATCTTGCGATCCTACT[C/A]
TCTGTTGAGGAGCTCCAAAGAGCTAGGTCTCAATTAACCCCTTGCCTTACTTGTGCAAAAACCCTAGAGGAAATCCACAGCCTTCAACCACAAACACCCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.30%	18.60%	0.02%	0.00%	NA
All Indica	2759	84.10%	15.80%	0.04%	0.00%	NA
All Japonica	1512	71.90%	28.10%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	88.00%	11.80%	0.22%	0.00%	NA
Indica III	913	68.50%	31.50%	0.00%	0.00%	NA
Indica Intermediate	786	88.00%	12.00%	0.00%	0.00%	NA
Temperate Japonica	767	99.10%	0.90%	0.00%	0.00%	NA
Tropical Japonica	504	34.90%	65.10%	0.00%	0.00%	NA
Japonica Intermediate	241	62.70%	37.30%	0.00%	0.00%	NA
VI/Aromatic	96	90.60%	9.40%	0.00%	0.00%	NA
Intermediate	90	88.90%	11.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0218613608	G -> T	LOC_Os02g31120.1	upstream_gene_variant ; 4520.0bp to feature; MODIFIER	silent_mutation	Average:31.733; most accessible tissue: Minghui63 flower, score: 40.98	N	N	N	N
vg0218613608	G -> T	LOC_Os02g31120-LOC_Os02g31140	intergenic_region ; MODIFIER	silent_mutation	Average:31.733; most accessible tissue: Minghui63 flower, score: 40.98	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0218613608	1.13E-06	NA	mr1076	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218613608	NA	5.27E-06	mr1076	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218613608	4.31E-06	NA	mr1082	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218613608	NA	2.70E-08	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218613608	7.31E-07	NA	mr1083	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218613608	7.18E-06	8.07E-09	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218613608	8.08E-06	NA	mr1226	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218613608	NA	3.34E-06	mr1226	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218613608	4.76E-07	8.14E-11	mr1408	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218613608	4.72E-06	5.81E-09	mr1408	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218613608	9.81E-06	NA	mr1411	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218613608	1.98E-06	NA	mr1560	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218613608	NA	3.87E-07	mr1560	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218613608	NA	4.27E-06	mr1606	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218613608	NA	4.91E-06	mr1964	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218613608	8.76E-06	NA	mr1104_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218613608	7.21E-07	7.21E-07	mr1159_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218613608	3.71E-06	3.71E-06	mr1374_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218613608	NA	5.34E-09	mr1408_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218613608	NA	5.35E-06	mr1689_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218613608	NA	4.57E-07	mr1793_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218613608	NA	2.52E-06	mr1812_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218613608	NA	4.21E-06	mr1816_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218613608	2.27E-06	2.27E-06	mr1832_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218613608	NA	3.12E-06	mr1833_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218613608	2.62E-06	2.62E-06	mr1847_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218613608	NA	6.72E-06	mr1851_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218613608	NA	3.31E-06	mr1970_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218613608	NA	4.99E-07	mr1973_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251