Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0218610194:

Variant ID: vg0218610194 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 18610194
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.84, G: 0.16, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:


GATGGCCACCCAGGGGCATGCAAGGAGTACTCCTTTCATCCTATAAAATGACAAGCTATTATCTCTATTCAGATTTATAGTATTAACATATGTTATATTT[A/G]
GTATTAGGTTGGTTTTTTAATAAAATGTGGAATTAGGATACTTCTTAAACTACTGCTACGTGGCAATTGGGAGGAAACCTTTTTTTGGGGGCATGGTGAG

Reverse complement sequence

CTCACCATGCCCCCAAAAAAAGGTTTCCTCCCAATTGCCACGTAGCAGTAGTTTAAGAAGTATCCTAATTCCACATTTTATTAAAAAACCAACCTAATAC[T/C]
AAATATAACATATGTTAATACTATAAATCTGAATAGAGATAATAGCTTGTCATTTTATAGGATGAAAGGAGTACTCCTTGCATGCCCCTGGGTGGCCATC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.70% 43.90% 0.34% 0.00% NA
All Indica  2759 42.80% 56.70% 0.43% 0.00% NA
All Japonica  1512 70.20% 29.70% 0.07% 0.00% NA
Aus  269 94.10% 5.90% 0.00% 0.00% NA
Indica I  595 43.40% 55.60% 1.01% 0.00% NA
Indica II  465 35.70% 63.90% 0.43% 0.00% NA
Indica III  913 51.20% 48.50% 0.33% 0.00% NA
Indica Intermediate  786 37.00% 62.80% 0.13% 0.00% NA
Temperate Japonica  767 97.80% 2.20% 0.00% 0.00% NA
Tropical Japonica  504 33.50% 66.50% 0.00% 0.00% NA
Japonica Intermediate  241 59.30% 40.20% 0.41% 0.00% NA
VI/Aromatic  96 88.50% 10.40% 1.04% 0.00% NA
Intermediate  90 56.70% 41.10% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0218610194 A -> G LOC_Os02g31120.1 upstream_gene_variant ; 1106.0bp to feature; MODIFIER silent_mutation Average:87.657; most accessible tissue: Minghui63 panicle, score: 96.585 N N N N
vg0218610194 A -> G LOC_Os02g31120-LOC_Os02g31140 intergenic_region ; MODIFIER silent_mutation Average:87.657; most accessible tissue: Minghui63 panicle, score: 96.585 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0218610194 A G 0.0 0.0 0.01 -0.02 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0218610194 NA 2.96E-07 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218610194 8.78E-06 4.73E-08 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218610194 NA 7.98E-06 mr1227 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218610194 NA 3.36E-06 mr1236 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218610194 NA 7.93E-06 mr1255 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218610194 NA 5.81E-06 mr1368 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218610194 3.19E-06 NA mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218610194 8.86E-07 5.17E-09 mr1408 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218610194 4.60E-06 3.71E-07 mr1560 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218610194 NA 9.43E-11 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218610194 NA 2.82E-07 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218610194 NA 4.47E-06 mr1970 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218610194 NA 4.57E-07 mr1045_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218610194 1.69E-06 1.69E-06 mr1159_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218610194 NA 3.71E-06 mr1229_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218610194 NA 4.35E-11 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218610194 NA 6.31E-07 mr1517_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218610194 NA 3.70E-06 mr1689_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218610194 NA 4.79E-06 mr1735_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218610194 NA 3.98E-06 mr1763_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218610194 NA 5.63E-06 mr1771_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218610194 NA 1.71E-06 mr1793_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218610194 NA 6.54E-14 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218610194 NA 1.70E-06 mr1880_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218610194 NA 3.14E-06 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218610194 NA 5.73E-07 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218610194 NA 1.21E-07 mr1970_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251