\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0218598781:

Variant ID: vg0218598781 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 18598781
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGCTGAGTTGGGGTTGGGGAAGCAGCGCCGTTGATGTTCTTTGGCTTGCTCAGTGTTCGATGGTTTTGATCGATGATTTTAGGGTTAGAACGTATCGCGA[C/T]
CGTATCGGGAATTTTTTTTATTATCTGAAAATCGTGAAAACAACCGATACGTACGAGATACGTATCGGGGCATATCCGATACTTATCCATATCCGATATG

Reverse complement sequence

CATATCGGATATGGATAAGTATCGGATATGCCCCGATACGTATCTCGTACGTATCGGTTGTTTTCACGATTTTCAGATAATAAAAAAAATTCCCGATACG[G/A]
TCGCGATACGTTCTAACCCTAAAATCATCGATCAAAACCATCGAACACTGAGCAAGCCAAAGAACATCAACGGCGCTGCTTCCCCAACCCCAACTCAGCT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.40% 28.60% 0.00% 0.00% NA
All Indica  2759 91.40% 8.60% 0.00% 0.00% NA
All Japonica  1512 29.90% 70.10% 0.00% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 99.00% 1.00% 0.00% 0.00% NA
Indica II  465 76.30% 23.70% 0.00% 0.00% NA
Indica III  913 93.20% 6.80% 0.00% 0.00% NA
Indica Intermediate  786 92.50% 7.50% 0.00% 0.00% NA
Temperate Japonica  767 2.10% 97.90% 0.00% 0.00% NA
Tropical Japonica  504 66.50% 33.50% 0.00% 0.00% NA
Japonica Intermediate  241 41.90% 58.10% 0.00% 0.00% NA
VI/Aromatic  96 75.00% 25.00% 0.00% 0.00% NA
Intermediate  90 71.10% 28.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0218598781 C -> T LOC_Os02g31110.1 synonymous_variant ; p.Asp72Asp; LOW synonymous_codon Average:70.182; most accessible tissue: Zhenshan97 panicle, score: 81.135 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0218598781 NA 9.98E-06 mr1074 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218598781 NA 2.68E-07 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218598781 NA 7.56E-08 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218598781 4.41E-06 1.81E-07 mr1124 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218598781 NA 3.05E-07 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218598781 NA 2.92E-06 mr1148 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218598781 NA 2.53E-09 mr1227 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218598781 NA 8.93E-06 mr1317 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218598781 NA 9.83E-06 mr1368 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218598781 8.94E-06 2.50E-08 mr1408 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218598781 NA 6.18E-08 mr1439 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218598781 NA 2.85E-06 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218598781 NA 1.81E-06 mr1560 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218598781 NA 5.70E-08 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218598781 NA 7.71E-17 mr1830 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218598781 NA 2.11E-10 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218598781 NA 1.09E-09 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218598781 NA 5.44E-06 mr1918 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218598781 NA 8.89E-06 mr1159_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218598781 2.41E-06 2.41E-06 mr1159_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218598781 NA 2.95E-06 mr1793_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218598781 NA 2.35E-11 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218598781 NA 5.65E-06 mr1863_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218598781 NA 2.05E-06 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218598781 NA 9.71E-07 mr1897_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218598781 NA 1.46E-07 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218598781 NA 1.03E-06 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251