\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0218591450:

Variant ID: vg0218591450 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 18591450
Reference Allele: GAlternative Allele: C,T
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTGACGACCCGATTACAACCGTACTAGACATTGTTGTCTTGCGCCTTAGCGATCGATACACCTCTCCGTGGGTTGTTGATCTTGCCGGTGCAGATCAAC[G/C,T]
TTATTCCTGCAAGCAAATCGAAGAAACAAGCAAGAATAAGATAAAAACAATCTGAATTGCAGATATGAATTGAATACAAATGATAGGTTGGGGTTCTGTA

Reverse complement sequence

TACAGAACCCCAACCTATCATTTGTATTCAATTCATATCTGCAATTCAGATTGTTTTTATCTTATTCTTGCTTGTTTCTTCGATTTGCTTGCAGGAATAA[C/G,A]
GTTGATCTGCACCGGCAAGATCAACAACCCACGGAGAGGTGTATCGATCGCTAAGGCGCAAGACAACAATGTCTAGTACGGTTGTAATCGGGTCGTCAAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.50% 28.30% 0.13% 0.04% NA
All Indica  2759 91.50% 8.20% 0.18% 0.07% NA
All Japonica  1512 30.00% 70.00% 0.00% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 99.20% 0.70% 0.17% 0.00% NA
Indica II  465 76.30% 23.20% 0.22% 0.22% NA
Indica III  913 93.40% 6.50% 0.11% 0.00% NA
Indica Intermediate  786 92.50% 7.10% 0.25% 0.13% NA
Temperate Japonica  767 2.10% 97.90% 0.00% 0.00% NA
Tropical Japonica  504 66.70% 33.30% 0.00% 0.00% NA
Japonica Intermediate  241 41.90% 58.10% 0.00% 0.00% NA
VI/Aromatic  96 75.00% 24.00% 1.04% 0.00% NA
Intermediate  90 72.20% 27.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0218591450 G -> T LOC_Os02g31090.1 downstream_gene_variant ; 549.0bp to feature; MODIFIER N Average:75.99; most accessible tissue: Zhenshan97 panicle, score: 86.788 N N N N
vg0218591450 G -> T LOC_Os02g31100.1 downstream_gene_variant ; 1066.0bp to feature; MODIFIER N Average:75.99; most accessible tissue: Zhenshan97 panicle, score: 86.788 N N N N
vg0218591450 G -> T LOC_Os02g31090-LOC_Os02g31100 intergenic_region ; MODIFIER N Average:75.99; most accessible tissue: Zhenshan97 panicle, score: 86.788 N N N N
vg0218591450 G -> DEL N N silent_mutation Average:75.99; most accessible tissue: Zhenshan97 panicle, score: 86.788 N N N N
vg0218591450 G -> C LOC_Os02g31090.1 downstream_gene_variant ; 549.0bp to feature; MODIFIER silent_mutation Average:75.99; most accessible tissue: Zhenshan97 panicle, score: 86.788 N N N N
vg0218591450 G -> C LOC_Os02g31100.1 downstream_gene_variant ; 1066.0bp to feature; MODIFIER silent_mutation Average:75.99; most accessible tissue: Zhenshan97 panicle, score: 86.788 N N N N
vg0218591450 G -> C LOC_Os02g31090-LOC_Os02g31100 intergenic_region ; MODIFIER silent_mutation Average:75.99; most accessible tissue: Zhenshan97 panicle, score: 86.788 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0218591450 NA 8.01E-07 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218591450 NA 1.10E-07 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218591450 NA 6.15E-09 mr1227 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218591450 NA 7.37E-06 mr1368 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218591450 8.29E-06 2.20E-08 mr1408 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218591450 NA 1.55E-07 mr1439 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218591450 NA 1.74E-06 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218591450 NA 3.49E-06 mr1560 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218591450 NA 1.43E-08 mr1660 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218591450 NA 8.84E-08 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218591450 NA 2.95E-16 mr1830 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218591450 1.20E-06 2.82E-11 mr1855 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218591450 NA 3.25E-09 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218591450 NA 2.33E-10 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218591450 3.11E-06 3.10E-06 mr1159_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218591450 NA 4.18E-06 mr1793_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218591450 NA 1.68E-08 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218591450 NA 2.96E-06 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251