Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0218591450:

Variant ID: vg0218591450 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 18591450
Reference Allele: G	Alternative Allele: C,T
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATTGACGACCCGATTACAACCGTACTAGACATTGTTGTCTTGCGCCTTAGCGATCGATACACCTCTCCGTGGGTTGTTGATCTTGCCGGTGCAGATCAAC[G/C,T]
TTATTCCTGCAAGCAAATCGAAGAAACAAGCAAGAATAAGATAAAAACAATCTGAATTGCAGATATGAATTGAATACAAATGATAGGTTGGGGTTCTGTA

Reverse complement sequence

TACAGAACCCCAACCTATCATTTGTATTCAATTCATATCTGCAATTCAGATTGTTTTTATCTTATTCTTGCTTGTTTCTTCGATTTGCTTGCAGGAATAA[C/G,A]
GTTGATCTGCACCGGCAAGATCAACAACCCACGGAGAGGTGTATCGATCGCTAAGGCGCAAGACAACAATGTCTAGTACGGTTGTAATCGGGTCGTCAAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.50%	28.30%	0.13%	0.04%	NA
All Indica	2759	91.50%	8.20%	0.18%	0.07%	NA
All Japonica	1512	30.00%	70.00%	0.00%	0.00%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	99.20%	0.70%	0.17%	0.00%	NA
Indica II	465	76.30%	23.20%	0.22%	0.22%	NA
Indica III	913	93.40%	6.50%	0.11%	0.00%	NA
Indica Intermediate	786	92.50%	7.10%	0.25%	0.13%	NA
Temperate Japonica	767	2.10%	97.90%	0.00%	0.00%	NA
Tropical Japonica	504	66.70%	33.30%	0.00%	0.00%	NA
Japonica Intermediate	241	41.90%	58.10%	0.00%	0.00%	NA
VI/Aromatic	96	75.00%	24.00%	1.04%	0.00%	NA
Intermediate	90	72.20%	27.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0218591450	G -> T	LOC_Os02g31090.1	downstream_gene_variant ; 549.0bp to feature; MODIFIER	N	Average:75.99; most accessible tissue: Zhenshan97 panicle, score: 86.788	N	N	N	N
vg0218591450	G -> T	LOC_Os02g31100.1	downstream_gene_variant ; 1066.0bp to feature; MODIFIER	N	Average:75.99; most accessible tissue: Zhenshan97 panicle, score: 86.788	N	N	N	N
vg0218591450	G -> T	LOC_Os02g31090-LOC_Os02g31100	intergenic_region ; MODIFIER	N	Average:75.99; most accessible tissue: Zhenshan97 panicle, score: 86.788	N	N	N	N
vg0218591450	G -> DEL	N	N	silent_mutation	Average:75.99; most accessible tissue: Zhenshan97 panicle, score: 86.788	N	N	N	N
vg0218591450	G -> C	LOC_Os02g31090.1	downstream_gene_variant ; 549.0bp to feature; MODIFIER	silent_mutation	Average:75.99; most accessible tissue: Zhenshan97 panicle, score: 86.788	N	N	N	N
vg0218591450	G -> C	LOC_Os02g31100.1	downstream_gene_variant ; 1066.0bp to feature; MODIFIER	silent_mutation	Average:75.99; most accessible tissue: Zhenshan97 panicle, score: 86.788	N	N	N	N
vg0218591450	G -> C	LOC_Os02g31090-LOC_Os02g31100	intergenic_region ; MODIFIER	silent_mutation	Average:75.99; most accessible tissue: Zhenshan97 panicle, score: 86.788	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0218591450	NA	8.01E-07	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218591450	NA	1.10E-07	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218591450	NA	6.15E-09	mr1227	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218591450	NA	7.37E-06	mr1368	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218591450	8.29E-06	2.20E-08	mr1408	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218591450	NA	1.55E-07	mr1439	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218591450	NA	1.74E-06	mr1445	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218591450	NA	3.49E-06	mr1560	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218591450	NA	1.43E-08	mr1660	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218591450	NA	8.84E-08	mr1690	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218591450	NA	2.95E-16	mr1830	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218591450	1.20E-06	2.82E-11	mr1855	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218591450	NA	3.25E-09	mr1866	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218591450	NA	2.33E-10	mr1921	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218591450	3.11E-06	3.10E-06	mr1159_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218591450	NA	4.18E-06	mr1793_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218591450	NA	1.68E-08	mr1855_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218591450	NA	2.96E-06	mr1914_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251