\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0218591225:

Variant ID: vg0218591225 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 18591225
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, C: 0.02, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:


GCGCGCCGCCTGCCGACATCTCCTTCCCCCACTGCCGCCGCGTCCCCCGTCATCGCCATCACCGCCGACGCACGCCACCGAGGCTGCCGATCTTGCAGAG[T/C]
AGAGAAGGGGGGAGAGAGACAAGGAAGAGAGAGGCTGATGAACCCTGAGCTCCACTCGAGACACTCAAGGCTGTTGTTGGCCCGATCTTTCAGTGAGTTG

Reverse complement sequence

CAACTCACTGAAAGATCGGGCCAACAACAGCCTTGAGTGTCTCGAGTGGAGCTCAGGGTTCATCAGCCTCTCTCTTCCTTGTCTCTCTCCCCCCTTCTCT[A/G]
CTCTGCAAGATCGGCAGCCTCGGTGGCGTGCGTCGGCGGTGATGGCGATGACGGGGGACGCGGCGGCAGTGGGGGAAGGAGATGTCGGCAGGCGGCGCGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.40% 46.50% 0.04% 0.00% NA
All Indica  2759 64.40% 35.60% 0.04% 0.00% NA
All Japonica  1512 29.70% 70.30% 0.00% 0.00% NA
Aus  269 65.10% 34.90% 0.00% 0.00% NA
Indica I  595 73.80% 26.20% 0.00% 0.00% NA
Indica II  465 67.70% 32.30% 0.00% 0.00% NA
Indica III  913 52.00% 47.90% 0.11% 0.00% NA
Indica Intermediate  786 69.70% 30.30% 0.00% 0.00% NA
Temperate Japonica  767 2.00% 98.00% 0.00% 0.00% NA
Tropical Japonica  504 66.30% 33.70% 0.00% 0.00% NA
Japonica Intermediate  241 41.50% 58.50% 0.00% 0.00% NA
VI/Aromatic  96 72.90% 27.10% 0.00% 0.00% NA
Intermediate  90 61.10% 37.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0218591225 T -> C LOC_Os02g31090.1 downstream_gene_variant ; 324.0bp to feature; MODIFIER silent_mutation Average:87.074; most accessible tissue: Zhenshan97 panicle, score: 90.661 N N N N
vg0218591225 T -> C LOC_Os02g31100.1 downstream_gene_variant ; 1291.0bp to feature; MODIFIER silent_mutation Average:87.074; most accessible tissue: Zhenshan97 panicle, score: 90.661 N N N N
vg0218591225 T -> C LOC_Os02g31090-LOC_Os02g31100 intergenic_region ; MODIFIER silent_mutation Average:87.074; most accessible tissue: Zhenshan97 panicle, score: 90.661 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0218591225 T C 0.01 -0.01 0.0 0.0 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0218591225 NA 6.66E-06 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218591225 NA 4.19E-07 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218591225 4.74E-06 4.02E-08 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218591225 NA 5.49E-07 mr1190 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218591225 NA 4.75E-06 mr1368 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218591225 1.49E-06 NA mr1408 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218591225 5.03E-07 2.21E-09 mr1408 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218591225 NA 8.29E-07 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218591225 NA 3.52E-07 mr1560 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218591225 NA 9.39E-06 mr1606 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218591225 NA 8.41E-06 mr1654 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218591225 NA 6.89E-06 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218591225 NA 8.22E-06 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218591225 NA 1.99E-08 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218591225 NA 9.91E-06 mr1793_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218591225 NA 2.08E-11 mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218591225 NA 8.19E-07 mr1970_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251