\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0218569230:

Variant ID: vg0218569230 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 18569230
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 300. )

Flanking Sequence (100 bp) in Reference Genome:


CTGGAAGAGTTGGTGTCCTGACTAATCTAACGACAGTTGATCTTCCCATGAACAGCTTCAATGGCACAACTCCAGAAAGCATCTACGCATGCAAACTTCA[G/T]
TAACTAATTTCCATACAAACTTCGTAGAAAACAATGAAGGTGAACCAGAATACTTCTATTATACTAGTAGTACTCGTAGATAGCACTATAGCAGTACAAC

Reverse complement sequence

GTTGTACTGCTATAGTGCTATCTACGAGTACTACTAGTATAATAGAAGTATTCTGGTTCACCTTCATTGTTTTCTACGAAGTTTGTATGGAAATTAGTTA[C/A]
TGAAGTTTGCATGCGTAGATGCTTTCTGGAGTTGTGCCATTGAAGCTGTTCATGGGAAGATCAACTGTCGTTAGATTAGTCAGGACACCAACTCTTCCAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.50% 2.30% 0.25% 0.00% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 92.10% 7.10% 0.79% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 93.70% 6.20% 0.20% 0.00% NA
Japonica Intermediate  241 65.10% 30.30% 4.56% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0218569230 G -> T LOC_Os02g31070.1 downstream_gene_variant ; 658.0bp to feature; MODIFIER silent_mutation Average:90.48; most accessible tissue: Zhenshan97 root, score: 93.592 N N N N
vg0218569230 G -> T LOC_Os02g31074.1 downstream_gene_variant ; 535.0bp to feature; MODIFIER silent_mutation Average:90.48; most accessible tissue: Zhenshan97 root, score: 93.592 N N N N
vg0218569230 G -> T LOC_Os02g31070.2 downstream_gene_variant ; 673.0bp to feature; MODIFIER silent_mutation Average:90.48; most accessible tissue: Zhenshan97 root, score: 93.592 N N N N
vg0218569230 G -> T LOC_Os02g31070.4 downstream_gene_variant ; 658.0bp to feature; MODIFIER silent_mutation Average:90.48; most accessible tissue: Zhenshan97 root, score: 93.592 N N N N
vg0218569230 G -> T LOC_Os02g31070.3 downstream_gene_variant ; 658.0bp to feature; MODIFIER silent_mutation Average:90.48; most accessible tissue: Zhenshan97 root, score: 93.592 N N N N
vg0218569230 G -> T LOC_Os02g31070-LOC_Os02g31074 intergenic_region ; MODIFIER silent_mutation Average:90.48; most accessible tissue: Zhenshan97 root, score: 93.592 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0218569230 G T 0.23 0.03 -0.03 -0.05 -0.01 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0218569230 5.72E-06 5.72E-06 mr1159_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218569230 8.98E-07 8.97E-07 mr1312_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218569230 NA 1.13E-07 mr1350_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218569230 NA 2.43E-06 mr1417_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218569230 9.18E-07 9.17E-07 mr1663_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218569230 NA 4.28E-06 mr1665_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218569230 NA 8.57E-06 mr1691_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218569230 NA 5.66E-06 mr1720_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218569230 NA 3.12E-06 mr1812_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218569230 1.74E-06 1.74E-06 mr1832_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218569230 NA 2.59E-06 mr1833_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218569230 2.92E-06 2.92E-06 mr1843_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218569230 4.35E-06 4.35E-06 mr1847_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251