\
| Variant ID: vg0218555416 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 18555416 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CCCGACGAGGCCCGACCTGCCCGAAACAGTGCCACATTTGCTTCTCTGCCCATTTGGCTAAATCAAGTGGTGCGGGGCATGTGCGGCGTGTGTCCCAGGC[G/A]
CCACCGTCCAAAGTGACTCAACGCTGGCGTCTTGTCCACGTCCTTTCAACTTAGACTGGCCAGGGATCCCCCTATAATCCTGTTTCATTTATGGCGGGGC
GCCCCGCCATAAATGAAACAGGATTATAGGGGGATCCCTGGCCAGTCTAAGTTGAAAGGACGTGGACAAGACGCCAGCGTTGAGTCACTTTGGACGGTGG[C/T]
GCCTGGGACACACGCCGCACATGCCCCGCACCACTTGATTTAGCCAAATGGGCAGAGAAGCAAATGTGGCACTGTTTCGGGCAGGTCGGGCCTCGTCGGG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.60% | 7.40% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 92.70% | 7.30% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 92.00% | 7.90% | 0.13% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 80.20% | 19.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 92.80% | 7.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 94.50% | 5.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 87.20% | 12.50% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 90.50% | 9.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 77.10% | 22.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0218555416 | G -> A | LOC_Os02g31050.1 | upstream_gene_variant ; 648.0bp to feature; MODIFIER | silent_mutation | Average:66.845; most accessible tissue: Zhenshan97 flag leaf, score: 80.156 | N | N | N | N |
| vg0218555416 | G -> A | LOC_Os02g31060.1 | upstream_gene_variant ; 1068.0bp to feature; MODIFIER | silent_mutation | Average:66.845; most accessible tissue: Zhenshan97 flag leaf, score: 80.156 | N | N | N | N |
| vg0218555416 | G -> A | LOC_Os02g31040.1 | downstream_gene_variant ; 3181.0bp to feature; MODIFIER | silent_mutation | Average:66.845; most accessible tissue: Zhenshan97 flag leaf, score: 80.156 | N | N | N | N |
| vg0218555416 | G -> A | LOC_Os02g31050-LOC_Os02g31060 | intergenic_region ; MODIFIER | silent_mutation | Average:66.845; most accessible tissue: Zhenshan97 flag leaf, score: 80.156 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0218555416 | 9.96E-06 | NA | mr1897 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218555416 | 3.02E-09 | 1.82E-11 | mr1317_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218555416 | 7.97E-11 | NA | mr1897_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218555416 | 4.74E-07 | 4.74E-07 | mr1897_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218555416 | 5.35E-09 | NA | mr1914_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218555416 | 4.12E-06 | 4.12E-06 | mr1914_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218555416 | 6.14E-07 | NA | mr1927_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |