\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0218555416:

Variant ID: vg0218555416 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 18555416
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCCGACGAGGCCCGACCTGCCCGAAACAGTGCCACATTTGCTTCTCTGCCCATTTGGCTAAATCAAGTGGTGCGGGGCATGTGCGGCGTGTGTCCCAGGC[G/A]
CCACCGTCCAAAGTGACTCAACGCTGGCGTCTTGTCCACGTCCTTTCAACTTAGACTGGCCAGGGATCCCCCTATAATCCTGTTTCATTTATGGCGGGGC

Reverse complement sequence

GCCCCGCCATAAATGAAACAGGATTATAGGGGGATCCCTGGCCAGTCTAAGTTGAAAGGACGTGGACAAGACGCCAGCGTTGAGTCACTTTGGACGGTGG[C/T]
GCCTGGGACACACGCCGCACATGCCCCGCACCACTTGATTTAGCCAAATGGGCAGAGAAGCAAATGTGGCACTGTTTCGGGCAGGTCGGGCCTCGTCGGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.60% 7.40% 0.04% 0.00% NA
All Indica  2759 92.70% 7.30% 0.00% 0.00% NA
All Japonica  1512 92.00% 7.90% 0.13% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 80.20% 19.80% 0.00% 0.00% NA
Indica III  913 92.80% 7.20% 0.00% 0.00% NA
Indica Intermediate  786 94.50% 5.50% 0.00% 0.00% NA
Temperate Japonica  767 87.20% 12.50% 0.26% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 90.50% 9.50% 0.00% 0.00% NA
VI/Aromatic  96 77.10% 22.90% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0218555416 G -> A LOC_Os02g31050.1 upstream_gene_variant ; 648.0bp to feature; MODIFIER silent_mutation Average:66.845; most accessible tissue: Zhenshan97 flag leaf, score: 80.156 N N N N
vg0218555416 G -> A LOC_Os02g31060.1 upstream_gene_variant ; 1068.0bp to feature; MODIFIER silent_mutation Average:66.845; most accessible tissue: Zhenshan97 flag leaf, score: 80.156 N N N N
vg0218555416 G -> A LOC_Os02g31040.1 downstream_gene_variant ; 3181.0bp to feature; MODIFIER silent_mutation Average:66.845; most accessible tissue: Zhenshan97 flag leaf, score: 80.156 N N N N
vg0218555416 G -> A LOC_Os02g31050-LOC_Os02g31060 intergenic_region ; MODIFIER silent_mutation Average:66.845; most accessible tissue: Zhenshan97 flag leaf, score: 80.156 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0218555416 9.96E-06 NA mr1897 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218555416 3.02E-09 1.82E-11 mr1317_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218555416 7.97E-11 NA mr1897_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218555416 4.74E-07 4.74E-07 mr1897_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218555416 5.35E-09 NA mr1914_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218555416 4.12E-06 4.12E-06 mr1914_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218555416 6.14E-07 NA mr1927_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251