Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0218547738:

Variant ID: vg0218547738 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 18547738
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGCCGGCGTCCCCGACATCTGCTCCGGCCCCGCCGTCCTCACCGGCTGGGCCACCACCGCCAGGGCTCGACTCCGACGCGACCGTGTGGGCTCGCCTCCG[C/A]
CGGCACGGCGCCCGCCACCCGCCTGGACACCTGCTCGGGCTGCTCCTCCGCCGCTGCCATCACCTCCAGTTTGCTCCTTGTTACGGTTGCGTGGTCTCGG

Reverse complement sequence

CCGAGACCACGCAACCGTAACAAGGAGCAAACTGGAGGTGATGGCAGCGGCGGAGGAGCAGCCCGAGCAGGTGTCCAGGCGGGTGGCGGGCGCCGTGCCG[G/T]
CGGAGGCGAGCCCACACGGTCGCGTCGGAGTCGAGCCCTGGCGGTGGTGGCCCAGCCGGTGAGGACGGCGGGGCCGGAGCAGATGTCGGGGACGCCGGCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.50% 7.40% 0.17% 0.00% NA
All Indica  2759 92.50% 7.40% 0.18% 0.00% NA
All Japonica  1512 92.10% 7.80% 0.13% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 79.80% 20.00% 0.22% 0.00% NA
Indica III  913 92.40% 7.30% 0.22% 0.00% NA
Indica Intermediate  786 94.30% 5.50% 0.25% 0.00% NA
Temperate Japonica  767 87.60% 12.10% 0.26% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 89.60% 10.40% 0.00% 0.00% NA
VI/Aromatic  96 77.10% 21.90% 1.04% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0218547738 C -> A LOC_Os02g31040.1 intron_variant ; MODIFIER silent_mutation Average:91.391; most accessible tissue: Zhenshan97 flower, score: 98.031 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0218547738 C A -0.01 0.0 -0.02 -0.02 -0.03 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0218547738 5.07E-06 NA mr1897 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218547738 3.05E-09 1.52E-11 mr1317_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218547738 4.95E-11 NA mr1897_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218547738 2.96E-07 2.96E-07 mr1897_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218547738 6.05E-09 NA mr1914_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218547738 1.62E-06 1.62E-06 mr1914_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218547738 3.16E-07 NA mr1927_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251