\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0218522108:

Variant ID: vg0218522108 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 18522108
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.79, T: 0.22, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:


ATGGTTAGTATTTTTAGTTTGTAAACAGAGTTTACAGAACTCATTTCCTCCTTCCAATTCCTTTTCACCAATTGCTCAGCACAGGGGAGTCTCCCTCTCC[C/T]
AACTAGATACAAAAAAATGTTTTATATTTAGAGGAATTCTACCTTTCCAAACTGCCCCCATTTAATACCCCAAAAGTTAAAATTTTGTACATTGATTTTG

Reverse complement sequence

CAAAATCAATGTACAAAATTTTAACTTTTGGGGTATTAAATGGGGGCAGTTTGGAAAGGTAGAATTCCTCTAAATATAAAACATTTTTTTGTATCTAGTT[G/A]
GGAGAGGGAGACTCCCCTGTGCTGAGCAATTGGTGAAAAGGAATTGGAAGGAGGAAATGAGTTCTGTAAACTCTGTTTACAAACTAAAAATACTAACCAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.90% 41.10% 0.02% 0.00% NA
All Indica  2759 86.70% 13.30% 0.00% 0.00% NA
All Japonica  1512 1.70% 98.30% 0.00% 0.00% NA
Aus  269 95.50% 4.50% 0.00% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 70.10% 29.90% 0.00% 0.00% NA
Indica III  913 85.00% 15.00% 0.00% 0.00% NA
Indica Intermediate  786 88.70% 11.30% 0.00% 0.00% NA
Temperate Japonica  767 1.20% 98.80% 0.00% 0.00% NA
Tropical Japonica  504 1.40% 98.60% 0.00% 0.00% NA
Japonica Intermediate  241 3.70% 96.30% 0.00% 0.00% NA
VI/Aromatic  96 61.50% 38.50% 0.00% 0.00% NA
Intermediate  90 55.60% 43.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0218522108 C -> T LOC_Os02g31000.1 upstream_gene_variant ; 3505.0bp to feature; MODIFIER silent_mutation Average:40.897; most accessible tissue: Minghui63 flag leaf, score: 52.137 N N N N
vg0218522108 C -> T LOC_Os02g31020.1 downstream_gene_variant ; 4814.0bp to feature; MODIFIER silent_mutation Average:40.897; most accessible tissue: Minghui63 flag leaf, score: 52.137 N N N N
vg0218522108 C -> T LOC_Os02g31010.1 intron_variant ; MODIFIER silent_mutation Average:40.897; most accessible tissue: Minghui63 flag leaf, score: 52.137 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0218522108 1.06E-07 NA mr1089 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218522108 NA 1.10E-07 mr1089 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218522108 1.41E-06 1.24E-42 mr1093 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218522108 4.33E-06 1.29E-09 mr1093 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218522108 NA 1.52E-07 mr1109 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218522108 NA 3.48E-06 mr1124 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218522108 3.74E-06 NA mr1129 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218522108 NA 5.36E-07 mr1129 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218522108 8.09E-08 5.98E-42 mr1235 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218522108 3.13E-06 4.98E-08 mr1235 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218522108 NA 1.16E-35 mr1243 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218522108 NA 3.30E-06 mr1243 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218522108 2.67E-07 5.36E-21 mr1253 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218522108 NA 1.37E-06 mr1253 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218522108 4.05E-06 NA mr1255 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218522108 NA 7.36E-08 mr1410 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218522108 NA 3.96E-30 mr1423 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218522108 NA 3.55E-06 mr1423 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218522108 NA 5.81E-13 mr1441 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218522108 NA 3.35E-06 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218522108 4.19E-06 7.41E-52 mr1599 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218522108 NA 3.65E-08 mr1599 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218522108 NA 4.89E-07 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218522108 7.88E-06 2.44E-51 mr1089_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218522108 NA 1.40E-08 mr1089_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218522108 4.28E-07 3.55E-54 mr1093_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218522108 NA 5.21E-10 mr1093_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218522108 NA 4.56E-10 mr1109_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218522108 NA 1.21E-06 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218522108 NA 1.36E-16 mr1146_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218522108 NA 5.22E-56 mr1235_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218522108 NA 1.66E-07 mr1235_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218522108 NA 3.94E-43 mr1243_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218522108 NA 2.59E-39 mr1251_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218522108 NA 8.91E-07 mr1251_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218522108 NA 4.32E-21 mr1253_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218522108 NA 1.18E-20 mr1255_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218522108 2.14E-06 3.34E-39 mr1257_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218522108 NA 8.38E-08 mr1257_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218522108 NA 6.22E-13 mr1377_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218522108 NA 8.60E-33 mr1423_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218522108 NA 5.22E-06 mr1423_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218522108 NA 3.17E-39 mr1435_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218522108 1.54E-06 5.56E-66 mr1599_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218522108 NA 4.07E-09 mr1599_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218522108 NA 2.51E-07 mr1821_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218522108 NA 6.07E-07 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251