\
| Variant ID: vg0218491418 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 18491418 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 113. )
AGAACACCTGCGCCCATCCCTTTGCCCTCAAGAATATTGCAGAAGTAGACAATGAACACAGATATAGGGTGGAGCTCTCTCTTCATTATAGATCTTATCT[G/A]
GAGTACAAGCCAACCATTAGCCATAGATGTCACACCCTCCCTCTGTATATATAGGGGTCTTAGGAGGAGATAGATCTTATCTCTACTCCGGTTCGGATTG
CAATCCGAACCGGAGTAGAGATAAGATCTATCTCCTCCTAAGACCCCTATATATACAGAGGGAGGGTGTGACATCTATGGCTAATGGTTGGCTTGTACTC[C/T]
AGATAAGATCTATAATGAAGAGAGAGCTCCACCCTATATCTGTGTTCATTGTCTACTTCTGCAATATTCTTGAGGGCAAAGGGATGGGCGCAGGTGTTCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.80% | 42.70% | 0.21% | 0.36% | NA |
| All Indica | 2759 | 51.00% | 48.10% | 0.33% | 0.54% | NA |
| All Japonica | 1512 | 58.20% | 41.70% | 0.07% | 0.00% | NA |
| Aus | 269 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 43.40% | 55.80% | 0.34% | 0.50% | NA |
| Indica II | 465 | 38.90% | 60.60% | 0.22% | 0.22% | NA |
| Indica III | 913 | 69.20% | 30.00% | 0.33% | 0.44% | NA |
| Indica Intermediate | 786 | 42.90% | 55.90% | 0.38% | 0.89% | NA |
| Temperate Japonica | 767 | 93.90% | 6.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 12.50% | 87.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 40.20% | 59.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 88.50% | 11.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 51.10% | 46.70% | 0.00% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0218491418 | G -> A | LOC_Os02g30955.1 | downstream_gene_variant ; 2964.0bp to feature; MODIFIER | silent_mutation | Average:63.277; most accessible tissue: Zhenshan97 panicle, score: 77.482 | N | N | N | N |
| vg0218491418 | G -> A | LOC_Os02g30960.1 | downstream_gene_variant ; 4149.0bp to feature; MODIFIER | silent_mutation | Average:63.277; most accessible tissue: Zhenshan97 panicle, score: 77.482 | N | N | N | N |
| vg0218491418 | G -> A | LOC_Os02g30940-LOC_Os02g30955 | intergenic_region ; MODIFIER | silent_mutation | Average:63.277; most accessible tissue: Zhenshan97 panicle, score: 77.482 | N | N | N | N |
| vg0218491418 | G -> DEL | N | N | silent_mutation | Average:63.277; most accessible tissue: Zhenshan97 panicle, score: 77.482 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0218491418 | 3.55E-06 | 5.67E-06 | mr1064 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218491418 | NA | 1.35E-06 | mr1109 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218491418 | NA | 2.57E-15 | mr1807 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218491418 | NA | 2.11E-06 | mr1807 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218491418 | NA | 2.28E-06 | mr1881 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218491418 | NA | 7.46E-07 | mr1129_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218491418 | NA | 4.49E-07 | mr1257_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218491418 | NA | 3.15E-06 | mr1608_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218491418 | NA | 4.59E-07 | mr1610_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218491418 | NA | 8.22E-10 | mr1855_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218491418 | NA | 9.91E-14 | mr1914_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218491418 | NA | 3.28E-08 | mr1914_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218491418 | NA | 1.37E-08 | mr1927_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |