\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0218491418:

Variant ID: vg0218491418 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 18491418
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


AGAACACCTGCGCCCATCCCTTTGCCCTCAAGAATATTGCAGAAGTAGACAATGAACACAGATATAGGGTGGAGCTCTCTCTTCATTATAGATCTTATCT[G/A]
GAGTACAAGCCAACCATTAGCCATAGATGTCACACCCTCCCTCTGTATATATAGGGGTCTTAGGAGGAGATAGATCTTATCTCTACTCCGGTTCGGATTG

Reverse complement sequence

CAATCCGAACCGGAGTAGAGATAAGATCTATCTCCTCCTAAGACCCCTATATATACAGAGGGAGGGTGTGACATCTATGGCTAATGGTTGGCTTGTACTC[C/T]
AGATAAGATCTATAATGAAGAGAGAGCTCCACCCTATATCTGTGTTCATTGTCTACTTCTGCAATATTCTTGAGGGCAAAGGGATGGGCGCAGGTGTTCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.80% 42.70% 0.21% 0.36% NA
All Indica  2759 51.00% 48.10% 0.33% 0.54% NA
All Japonica  1512 58.20% 41.70% 0.07% 0.00% NA
Aus  269 98.10% 1.90% 0.00% 0.00% NA
Indica I  595 43.40% 55.80% 0.34% 0.50% NA
Indica II  465 38.90% 60.60% 0.22% 0.22% NA
Indica III  913 69.20% 30.00% 0.33% 0.44% NA
Indica Intermediate  786 42.90% 55.90% 0.38% 0.89% NA
Temperate Japonica  767 93.90% 6.00% 0.13% 0.00% NA
Tropical Japonica  504 12.50% 87.50% 0.00% 0.00% NA
Japonica Intermediate  241 40.20% 59.80% 0.00% 0.00% NA
VI/Aromatic  96 88.50% 11.50% 0.00% 0.00% NA
Intermediate  90 51.10% 46.70% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0218491418 G -> A LOC_Os02g30955.1 downstream_gene_variant ; 2964.0bp to feature; MODIFIER silent_mutation Average:63.277; most accessible tissue: Zhenshan97 panicle, score: 77.482 N N N N
vg0218491418 G -> A LOC_Os02g30960.1 downstream_gene_variant ; 4149.0bp to feature; MODIFIER silent_mutation Average:63.277; most accessible tissue: Zhenshan97 panicle, score: 77.482 N N N N
vg0218491418 G -> A LOC_Os02g30940-LOC_Os02g30955 intergenic_region ; MODIFIER silent_mutation Average:63.277; most accessible tissue: Zhenshan97 panicle, score: 77.482 N N N N
vg0218491418 G -> DEL N N silent_mutation Average:63.277; most accessible tissue: Zhenshan97 panicle, score: 77.482 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0218491418 3.55E-06 5.67E-06 mr1064 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218491418 NA 1.35E-06 mr1109 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218491418 NA 2.57E-15 mr1807 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218491418 NA 2.11E-06 mr1807 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218491418 NA 2.28E-06 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218491418 NA 7.46E-07 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218491418 NA 4.49E-07 mr1257_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218491418 NA 3.15E-06 mr1608_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218491418 NA 4.59E-07 mr1610_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218491418 NA 8.22E-10 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218491418 NA 9.91E-14 mr1914_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218491418 NA 3.28E-08 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218491418 NA 1.37E-08 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251