Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0218489541:

Variant ID: vg0218489541 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 18489541
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:

AGAGAGGGAAGGGGAGGGGGGGAATTAGGGTTTCCCCTTTCCCATTCATTGTCCGCAACGACGTCCACCGCCCGGCGCACCGGCCCCTCAGGCACGGCGG[C/T]
GGCATTGGAGGCCATTGACTGTCGACTTTGAAGGGATTTAGGGCGGTGCACGGCGAGGAGGTCATCGACGACCCATCCACTACACCGATTGGCAGGACGG

Reverse complement sequence

CCGTCCTGCCAATCGGTGTAGTGGATGGGTCGTCGATGACCTCCTCGCCGTGCACCGCCCTAAATCCCTTCAAAGTCGACAGTCAATGGCCTCCAATGCC[G/A]
CCGCCGTGCCTGAGGGGCCGGTGCGCCGGGCGGTGGACGTCGTTGCGGACAATGAATGGGAAAGGGGAAACCCTAATTCCCCCCCTCCCCTTCCCTCTCT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.60%	28.00%	0.34%	0.00%	NA
All Indica	2759	87.00%	13.00%	0.00%	0.00%	NA
All Japonica	1512	39.60%	59.30%	1.06%	0.00%	NA
Aus	269	95.90%	4.10%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	71.60%	28.40%	0.00%	0.00%	NA
Indica III	913	85.10%	14.90%	0.00%	0.00%	NA
Indica Intermediate	786	88.70%	11.30%	0.00%	0.00%	NA
Temperate Japonica	767	70.00%	28.40%	1.56%	0.00%	NA
Tropical Japonica	504	2.60%	97.20%	0.20%	0.00%	NA
Japonica Intermediate	241	20.30%	78.40%	1.24%	0.00%	NA
VI/Aromatic	96	65.60%	34.40%	0.00%	0.00%	NA
Intermediate	90	72.20%	27.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0218489541	C -> T	LOC_Os02g30955.1	downstream_gene_variant ; 4841.0bp to feature; MODIFIER	silent_mutation	Average:66.39; most accessible tissue: Zhenshan97 panicle, score: 81.135	N	N	N	N
vg0218489541	C -> T	LOC_Os02g30940-LOC_Os02g30955	intergenic_region ; MODIFIER	silent_mutation	Average:66.39; most accessible tissue: Zhenshan97 panicle, score: 81.135	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0218489541	NA	1.06E-07	mr1089	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218489541	1.77E-06	5.32E-10	mr1093	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218489541	NA	5.01E-07	mr1109	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218489541	NA	3.23E-07	mr1129	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218489541	NA	1.34E-08	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218489541	NA	3.38E-06	mr1192	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218489541	6.10E-06	8.83E-08	mr1235	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218489541	NA	3.71E-06	mr1253	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218489541	NA	5.92E-08	mr1410	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218489541	NA	5.29E-06	mr1423	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218489541	NA	1.07E-08	mr1563	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218489541	NA	4.06E-08	mr1599	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218489541	NA	1.21E-08	mr1089_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218489541	NA	7.46E-10	mr1093_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218489541	NA	3.39E-09	mr1109_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218489541	NA	1.14E-06	mr1129_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218489541	NA	1.91E-07	mr1235_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218489541	NA	4.59E-06	mr1243_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218489541	NA	8.93E-07	mr1251_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218489541	NA	1.06E-07	mr1257_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218489541	3.63E-06	NA	mr1317_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218489541	NA	7.11E-09	mr1354_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218489541	NA	1.48E-08	mr1563_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218489541	NA	5.87E-09	mr1599_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218489541	NA	9.91E-06	mr1863_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218489541	6.90E-08	NA	mr1914_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218489541	NA	1.94E-07	mr1914_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218489541	NA	9.95E-06	mr1927_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251