Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0218467788:

Variant ID: vg0218467788 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 18467788
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


TGCAATATTGATCAGCTTTTATTTATGTCGAAGGCAACCAGTAGTAGTGGGAGGAGGAAGTAGGGGAGCCACTGCTTAATCGATAACAATATACTTTTTC[C/T]
GTAAAAAAAAACTCAATCTAAGAAAGGTCACAACAAATTTGAATAATTATTATATAGATTTGTCGTATCAAGAACGGTCACAAGTTTTGAGTTTTTTTTA

Reverse complement sequence

TAAAAAAAACTCAAAACTTGTGACCGTTCTTGATACGACAAATCTATATAATAATTATTCAAATTTGTTGTGACCTTTCTTAGATTGAGTTTTTTTTTAC[G/A]
GAAAAAGTATATTGTTATCGATTAAGCAGTGGCTCCCCTACTTCCTCCTCCCACTACTACTGGTTGCCTTCGACATAAATAAAAGCTGATCAATATTGCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.60% 9.40% 0.53% 1.42% NA
All Indica  2759 91.40% 7.90% 0.22% 0.54% NA
All Japonica  1512 83.50% 12.00% 1.12% 3.31% NA
Aus  269 94.10% 5.60% 0.37% 0.00% NA
Indica I  595 99.70% 0.20% 0.00% 0.17% NA
Indica II  465 79.80% 19.40% 0.86% 0.00% NA
Indica III  913 90.30% 8.80% 0.11% 0.88% NA
Indica Intermediate  786 93.30% 5.90% 0.13% 0.76% NA
Temperate Japonica  767 82.50% 15.10% 1.83% 0.52% NA
Tropical Japonica  504 83.50% 8.90% 0.40% 7.14% NA
Japonica Intermediate  241 86.70% 8.70% 0.41% 4.15% NA
VI/Aromatic  96 74.00% 25.00% 0.00% 1.04% NA
Intermediate  90 90.00% 7.80% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0218467788 C -> T LOC_Os02g30920.1 downstream_gene_variant ; 1337.0bp to feature; MODIFIER silent_mutation Average:73.341; most accessible tissue: Callus, score: 95.214 N N N N
vg0218467788 C -> T LOC_Os02g30910-LOC_Os02g30920 intergenic_region ; MODIFIER silent_mutation Average:73.341; most accessible tissue: Callus, score: 95.214 N N N N
vg0218467788 C -> DEL N N silent_mutation Average:73.341; most accessible tissue: Callus, score: 95.214 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0218467788 C T -0.02 -0.02 -0.02 -0.03 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0218467788 NA 7.26E-07 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218467788 NA 3.11E-09 mr1317 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218467788 3.47E-06 5.76E-06 mr1603 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218467788 NA 7.48E-07 mr1818 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218467788 7.92E-08 3.78E-17 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218467788 NA 2.16E-08 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218467788 NA 4.65E-06 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218467788 3.48E-07 2.06E-14 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218467788 NA 2.15E-06 mr1897_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218467788 NA 2.98E-08 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218467788 NA 6.40E-07 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251