Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0218455790:

Variant ID: vg0218455790 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 18455790
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 304. )

Flanking Sequence (100 bp) in Reference Genome:


CATCCACAGCATGCAGCTGAAGAGCGTCACCACGTACGGCGTCGACTGGAACCCCTCCGTCGACTTCTTCCGGTACACCCGGTAGAACGTCGGCCTGCAC[G/T]
CCAAACGCACGCATGCACACACGGTTAAGTTATTGTTCAACCTGCTAATAATTAGTTATCAACAAACTAGCTAACAGCAGTTTCTTTCGTCTGATTAATG

Reverse complement sequence

CATTAATCAGACGAAAGAAACTGCTGTTAGCTAGTTTGTTGATAACTAATTATTAGCAGGTTGAACAATAACTTAACCGTGTGTGCATGCGTGCGTTTGG[C/A]
GTGCAGGCCGACGTTCTACCGGGTGTACCGGAAGAAGTCGACGGAGGGGTTCCAGTCGACGCCGTACGTGGTGACGCTCTTCAGCTGCATGCTGTGGATG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.80% 9.70% 0.36% 0.21% NA
All Indica  2759 91.80% 7.60% 0.18% 0.36% NA
All Japonica  1512 88.80% 10.60% 0.60% 0.00% NA
Aus  269 95.20% 4.80% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 79.10% 19.40% 0.43% 1.08% NA
Indica III  913 90.90% 8.70% 0.22% 0.22% NA
Indica Intermediate  786 94.10% 5.30% 0.13% 0.38% NA
Temperate Japonica  767 87.60% 11.30% 1.04% 0.00% NA
Tropical Japonica  504 90.50% 9.30% 0.20% 0.00% NA
Japonica Intermediate  241 88.80% 11.20% 0.00% 0.00% NA
VI/Aromatic  96 34.40% 63.50% 2.08% 0.00% NA
Intermediate  90 86.70% 12.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0218455790 G -> T LOC_Os02g30910.1 splice_region_variant&intron_variant ; LOW silent_mutation Average:79.373; most accessible tissue: Zhenshan97 flower, score: 93.427 N N N N
vg0218455790 G -> DEL N N silent_mutation Average:79.373; most accessible tissue: Zhenshan97 flower, score: 93.427 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0218455790 G T -0.04 -0.03 -0.03 -0.01 -0.02 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0218455790 NA 3.01E-06 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218455790 1.00E-07 1.67E-08 mr1180 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218455790 2.04E-06 5.88E-07 mr1183 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218455790 NA 2.57E-06 mr1317 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218455790 8.21E-06 1.89E-06 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218455790 NA 3.20E-12 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218455790 NA 1.86E-06 mr1931 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218455790 NA 4.60E-06 mr1931 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218455790 4.43E-06 1.24E-10 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218455790 NA 2.07E-06 mr1896_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251