\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0218455087:

Variant ID: vg0218455087 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 18455087
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCTGATCCTGCCCTCCGGCGCTGCCGCGACGGCGCCCTTGGCGACGGCCTGCACCTCCTTGACATGCTCCGGCAGCTTGATCTCCAGCCCGGCCGCCACC[A/G]
CGGCGGACGACGACGACGCCACCAGTGGCTTCTTGCTCCGGTACGCCATGTACAGCGCCATCTGCGCCACGCCGAACACGAAGCCCAGCACGTTGGGCAG

Reverse complement sequence

CTGCCCAACGTGCTGGGCTTCGTGTTCGGCGTGGCGCAGATGGCGCTGTACATGGCGTACCGGAGCAAGAAGCCACTGGTGGCGTCGTCGTCGTCCGCCG[T/C]
GGTGGCGGCCGGGCTGGAGATCAAGCTGCCGGAGCATGTCAAGGAGGTGCAGGCCGTCGCCAAGGGCGCCGTCGCGGCAGCGCCGGAGGGCAGGATCAGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.20% 25.10% 0.40% 0.28% NA
All Indica  2759 91.20% 8.30% 0.40% 0.11% NA
All Japonica  1512 42.50% 56.70% 0.26% 0.60% NA
Aus  269 94.40% 4.80% 0.74% 0.00% NA
Indica I  595 99.30% 0.70% 0.00% 0.00% NA
Indica II  465 77.60% 20.90% 1.29% 0.22% NA
Indica III  913 90.80% 8.90% 0.22% 0.11% NA
Indica Intermediate  786 93.50% 6.00% 0.38% 0.13% NA
Temperate Japonica  767 6.30% 93.10% 0.13% 0.52% NA
Tropical Japonica  504 88.90% 10.10% 0.60% 0.40% NA
Japonica Intermediate  241 60.60% 38.20% 0.00% 1.24% NA
VI/Aromatic  96 28.10% 69.80% 2.08% 0.00% NA
Intermediate  90 75.60% 23.30% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0218455087 A -> G LOC_Os02g30910.1 missense_variant ; p.Val229Ala; MODERATE nonsynonymous_codon ; V229A Average:83.757; most accessible tissue: Zhenshan97 flower, score: 95.978 unknown unknown TOLERATED 1.00
vg0218455087 A -> DEL LOC_Os02g30910.1 N frameshift_variant Average:83.757; most accessible tissue: Zhenshan97 flower, score: 95.978 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0218455087 A G -0.01 -0.01 -0.01 0.0 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0218455087 NA 8.52E-09 mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218455087 NA 8.80E-06 mr1295 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218455087 NA 2.02E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218455087 NA 1.62E-07 mr1439 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218455087 NA 4.52E-07 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218455087 9.56E-06 NA mr1585 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218455087 NA 3.28E-08 mr1606 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218455087 NA 1.27E-13 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218455087 NA 1.46E-20 mr1830 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218455087 NA 8.87E-11 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218455087 NA 7.36E-10 mr1889 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218455087 NA 6.33E-06 mr1931 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218455087 NA 6.00E-06 mr1168_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218455087 NA 2.66E-06 mr1322_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218455087 NA 8.29E-06 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218455087 NA 3.71E-13 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218455087 NA 5.57E-10 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218455087 NA 1.54E-08 mr1889_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218455087 NA 6.20E-06 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218455087 NA 1.42E-09 mr1896_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251