Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0218451233:

Variant ID: vg0218451233 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 18451233
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 318. )

Flanking Sequence (100 bp) in Reference Genome:


CACGACGCAACACGCAAAGCCTAAACGGACGGAGACTTTAGACGAGAAGGCGACGCTACCGTAGGCATGAACCACCACGGTCCAAAAGGGTATGGGTGCA[T/A]
ACACAAAAATAGACATACGCCCACAGTGAAGGGCCGCCATCCAACATGCACTTCAGACTCATTAGTAGGCCCAAACCAGCACATTTTCCTTACTACTTTG

Reverse complement sequence

CAAAGTAGTAAGGAAAATGTGCTGGTTTGGGCCTACTAATGAGTCTGAAGTGCATGTTGGATGGCGGCCCTTCACTGTGGGCGTATGTCTATTTTTGTGT[A/T]
TGCACCCATACCCTTTTGGACCGTGGTGGTTCATGCCTACGGTAGCGTCGCCTTCTCGTCTAAAGTCTCCGTCCGTTTAGGCTTTGCGTGTTGCGTCGTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.40% 11.30% 0.23% 0.00% NA
All Indica  2759 88.80% 11.10% 0.11% 0.00% NA
All Japonica  1512 90.70% 8.90% 0.46% 0.00% NA
Aus  269 94.10% 5.60% 0.37% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 72.90% 27.10% 0.00% 0.00% NA
Indica III  913 87.80% 11.90% 0.22% 0.00% NA
Indica Intermediate  786 90.80% 9.00% 0.13% 0.00% NA
Temperate Japonica  767 91.40% 8.10% 0.52% 0.00% NA
Tropical Japonica  504 90.70% 8.90% 0.40% 0.00% NA
Japonica Intermediate  241 88.40% 11.20% 0.41% 0.00% NA
VI/Aromatic  96 32.30% 67.70% 0.00% 0.00% NA
Intermediate  90 83.30% 16.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0218451233 T -> A LOC_Os02g30900.1 downstream_gene_variant ; 721.0bp to feature; MODIFIER silent_mutation Average:98.598; most accessible tissue: Zhenshan97 flower, score: 99.48 N N N N
vg0218451233 T -> A LOC_Os02g30910.1 downstream_gene_variant ; 3171.0bp to feature; MODIFIER silent_mutation Average:98.598; most accessible tissue: Zhenshan97 flower, score: 99.48 N N N N
vg0218451233 T -> A LOC_Os02g30900-LOC_Os02g30910 intergenic_region ; MODIFIER silent_mutation Average:98.598; most accessible tissue: Zhenshan97 flower, score: 99.48 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0218451233 T A 0.01 0.01 0.05 0.03 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0218451233 NA 7.34E-07 mr1069 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218451233 NA 4.55E-06 mr1089 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218451233 NA 1.34E-07 mr1093 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218451233 NA 5.27E-06 mr1149 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218451233 3.99E-07 1.31E-09 mr1180 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218451233 2.57E-06 1.40E-08 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218451233 NA 2.94E-06 mr1303 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218451233 NA 9.91E-06 mr1432 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218451233 NA 1.01E-07 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218451233 NA 3.35E-08 mr1931 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218451233 NA 1.49E-07 mr1958 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251