Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0218342899:

Variant ID: vg0218342899 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 18342899
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.01, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:


ACCCATTCCATCCCACCAACCAAACATCACCCAAGCATACAAAGAAAAAAGGGTAGCACCCAAAAGATTGTTGAATAGTCCCACATTGGTTATGGAAGGG[C/T]
AAAGGACCTAAGATATAAGTGGGGGAGCCCCTCACCTCAATGGCTAGCTTTTGGGGTGGGAAAGGCCATTTACGATCCTACAATTGGTATCAGAGCCTGG

Reverse complement sequence

CCAGGCTCTGATACCAATTGTAGGATCGTAAATGGCCTTTCCCACCCCAAAAGCTAGCCATTGAGGTGAGGGGCTCCCCCACTTATATCTTAGGTCCTTT[G/A]
CCCTTCCATAACCAATGTGGGACTATTCAACAATCTTTTGGGTGCTACCCTTTTTTCTTTGTATGCTTGGGTGATGTTTGGTTGGTGGGATGGAATGGGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.40% 14.20% 0.34% 0.00% NA
All Indica  2759 83.00% 16.50% 0.51% 0.00% NA
All Japonica  1512 99.60% 0.30% 0.07% 0.00% NA
Aus  269 29.00% 71.00% 0.00% 0.00% NA
Indica I  595 81.30% 18.30% 0.34% 0.00% NA
Indica II  465 74.20% 24.70% 1.08% 0.00% NA
Indica III  913 88.80% 10.70% 0.44% 0.00% NA
Indica Intermediate  786 82.70% 16.90% 0.38% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.00% 0.80% 0.20% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 82.20% 16.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0218342899 C -> T LOC_Os02g30790.1 downstream_gene_variant ; 664.0bp to feature; MODIFIER silent_mutation Average:65.464; most accessible tissue: Zhenshan97 young leaf, score: 83.623 N N N N
vg0218342899 C -> T LOC_Os02g30780-LOC_Os02g30790 intergenic_region ; MODIFIER silent_mutation Average:65.464; most accessible tissue: Zhenshan97 young leaf, score: 83.623 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0218342899 NA 2.47E-06 mr1138 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218342899 NA 9.95E-15 mr1317 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218342899 9.81E-06 3.94E-15 mr1317 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218342899 NA 6.26E-07 mr1603 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218342899 NA 3.92E-07 mr1649 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218342899 NA 4.86E-08 mr1818 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218342899 NA 8.98E-07 mr1830 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218342899 NA 1.51E-44 mr1855 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218342899 8.00E-06 2.06E-27 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218342899 NA 5.53E-12 mr1897 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218342899 NA 1.65E-10 mr1927 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218342899 3.68E-06 NA mr1138_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218342899 1.26E-06 NA mr1138_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218342899 NA 7.31E-17 mr1317_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218342899 NA 8.59E-14 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218342899 NA 1.03E-10 mr1608_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218342899 NA 4.73E-07 mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218342899 NA 3.30E-13 mr1610_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218342899 NA 5.74E-08 mr1610_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218342899 NA 8.30E-06 mr1649_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218342899 NA 3.91E-19 mr1818_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218342899 NA 1.51E-11 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218342899 2.28E-07 8.06E-50 mr1855_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218342899 2.97E-06 2.53E-28 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218342899 NA 1.60E-16 mr1897_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218342899 NA 5.90E-09 mr1897_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218342899 NA 2.71E-19 mr1914_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218342899 NA 1.12E-15 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218342899 NA 4.29E-23 mr1927_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218342899 NA 1.06E-14 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251