\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0218324782:

Variant ID: vg0218324782 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 18324782
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCCACGCCGCCGCTGCGCCAAGCTGCAGCCGCGTAGCCCCGCCGCCGCTCCGCTGCCGCCACGTGAACGAATGAACGTGAACGAGAACGTGAACGTGAAC[G/A]
AACGAACGTGAACGTGAACGTGAACATGAACGAACGAACGTGAACATGAACGTGAACGAGAACGTGAACGAACGAAATGTACGTGAACGAGAACGTGAAC

Reverse complement sequence

GTTCACGTTCTCGTTCACGTACATTTCGTTCGTTCACGTTCTCGTTCACGTTCATGTTCACGTTCGTTCGTTCATGTTCACGTTCACGTTCACGTTCGTT[C/T]
GTTCACGTTCACGTTCTCGTTCACGTTCATTCGTTCACGTGGCGGCAGCGGAGCGGCGGCGGGGCTACGCGGCTGCAGCTTGGCGCAGCGGCGGCGTGGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.70% 14.20% 0.15% 0.00% NA
All Indica  2759 83.30% 16.50% 0.22% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 29.00% 71.00% 0.00% 0.00% NA
Indica I  595 81.70% 18.20% 0.17% 0.00% NA
Indica II  465 74.40% 24.90% 0.65% 0.00% NA
Indica III  913 89.30% 10.60% 0.11% 0.00% NA
Indica Intermediate  786 82.80% 17.00% 0.13% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.20% 0.80% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 83.30% 15.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0218324782 G -> A LOC_Os02g30750.1 upstream_gene_variant ; 46.0bp to feature; MODIFIER silent_mutation Average:58.658; most accessible tissue: Minghui63 young leaf, score: 76.82 N N N N
vg0218324782 G -> A LOC_Os02g30770.1 upstream_gene_variant ; 4377.0bp to feature; MODIFIER silent_mutation Average:58.658; most accessible tissue: Minghui63 young leaf, score: 76.82 N N N N
vg0218324782 G -> A LOC_Os02g30740.1 downstream_gene_variant ; 1521.0bp to feature; MODIFIER silent_mutation Average:58.658; most accessible tissue: Minghui63 young leaf, score: 76.82 N N N N
vg0218324782 G -> A LOC_Os02g30760.1 downstream_gene_variant ; 2414.0bp to feature; MODIFIER silent_mutation Average:58.658; most accessible tissue: Minghui63 young leaf, score: 76.82 N N N N
vg0218324782 G -> A LOC_Os02g30740-LOC_Os02g30750 intergenic_region ; MODIFIER silent_mutation Average:58.658; most accessible tissue: Minghui63 young leaf, score: 76.82 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0218324782 6.77E-07 5.66E-17 mr1317 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218324782 8.74E-09 8.34E-18 mr1317 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218324782 4.81E-07 5.15E-09 mr1603 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218324782 NA 1.29E-08 mr1608 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218324782 NA 6.30E-06 mr1608 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218324782 NA 1.56E-08 mr1818 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218324782 3.06E-07 6.91E-50 mr1855 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218324782 4.16E-09 3.61E-32 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218324782 NA 3.17E-14 mr1897 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218324782 NA 3.40E-06 mr1897 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218324782 NA 1.87E-06 mr1914 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218324782 NA 1.25E-10 mr1927 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218324782 NA 4.43E-06 mr1927 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218324782 NA 5.78E-07 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218324782 3.80E-06 3.29E-21 mr1317_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218324782 4.04E-06 3.82E-19 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218324782 NA 8.70E-14 mr1608_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218324782 NA 1.69E-10 mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218324782 NA 3.13E-16 mr1610_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218324782 NA 3.70E-11 mr1610_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218324782 4.01E-07 2.95E-24 mr1818_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218324782 8.29E-07 2.92E-16 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218324782 2.15E-07 4.51E-54 mr1855_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218324782 1.48E-09 3.62E-32 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218324782 NA 7.07E-20 mr1897_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218324782 NA 1.63E-12 mr1897_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218324782 NA 3.56E-23 mr1914_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218324782 8.23E-06 4.01E-20 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218324782 3.16E-06 6.38E-27 mr1927_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218324782 NA 8.41E-19 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251