\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0218320728:

Variant ID: vg0218320728 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 18320728
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 124. )

Flanking Sequence (100 bp) in Reference Genome:


CATGCCCTGTTTGCAAAGCACTACGATACAAGATTTGACGAGACGATCCAGGAGAAGTTGACGGGCAGCTAACAAAGAAGAGAATTCCTGCTAAGGTGAT[G/A]
TGGTATTTCCCTATAATACCACGGTTAAGGCGTTTGTTCAGGAACAAGGGGAATGCTAGAATGATGCGATGGCACGCTGAAGAGCGTCAACAGGACGGGA

Reverse complement sequence

TCCCGTCCTGTTGACGCTCTTCAGCGTGCCATCGCATCATTCTAGCATTCCCCTTGTTCCTGAACAAACGCCTTAACCGTGGTATTATAGGGAAATACCA[C/T]
ATCACCTTAGCAGGAATTCTCTTCTTTGTTAGCTGCCCGTCAACTTCTCCTGGATCGTCTCGTCAAATCTTGTATCGTAGTGCTTTGCAAACAGGGCATG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.10% 12.50% 5.37% 0.00% NA
All Indica  2759 92.20% 2.00% 5.87% 0.00% NA
All Japonica  1512 62.80% 34.40% 2.84% 0.00% NA
Aus  269 85.10% 0.00% 14.87% 0.00% NA
Indica I  595 90.60% 0.00% 9.41% 0.00% NA
Indica II  465 85.60% 3.00% 11.40% 0.00% NA
Indica III  913 95.90% 2.50% 1.53% 0.00% NA
Indica Intermediate  786 92.90% 2.20% 4.96% 0.00% NA
Temperate Japonica  767 96.00% 3.80% 0.26% 0.00% NA
Tropical Japonica  504 17.30% 77.00% 5.75% 0.00% NA
Japonica Intermediate  241 52.30% 42.70% 4.98% 0.00% NA
VI/Aromatic  96 88.50% 7.30% 4.17% 0.00% NA
Intermediate  90 81.10% 13.30% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0218320728 G -> A LOC_Os02g30730.1 upstream_gene_variant ; 3431.0bp to feature; MODIFIER silent_mutation Average:20.339; most accessible tissue: Zhenshan97 root, score: 38.035 N N N N
vg0218320728 G -> A LOC_Os02g30750.1 upstream_gene_variant ; 4100.0bp to feature; MODIFIER silent_mutation Average:20.339; most accessible tissue: Zhenshan97 root, score: 38.035 N N N N
vg0218320728 G -> A LOC_Os02g30730.2 upstream_gene_variant ; 3431.0bp to feature; MODIFIER silent_mutation Average:20.339; most accessible tissue: Zhenshan97 root, score: 38.035 N N N N
vg0218320728 G -> A LOC_Os02g30740.1 intron_variant ; MODIFIER silent_mutation Average:20.339; most accessible tissue: Zhenshan97 root, score: 38.035 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0218320728 7.06E-07 NA mr1076 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218320728 6.97E-07 NA mr1082 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218320728 6.48E-07 NA mr1083 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218320728 4.63E-06 NA mr1204 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218320728 NA 1.40E-18 mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218320728 NA 9.49E-06 mr1388 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218320728 5.76E-06 1.39E-10 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218320728 1.28E-06 NA mr1411 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218320728 7.33E-06 NA mr1436 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218320728 NA 1.15E-08 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218320728 5.80E-08 NA mr1560 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218320728 NA 6.51E-06 mr1600 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218320728 NA 6.10E-09 mr1916 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218320728 NA 4.84E-08 mr1156_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218320728 NA 6.86E-08 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218320728 NA 4.70E-08 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218320728 NA 1.79E-07 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218320728 NA 8.11E-06 mr1665_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218320728 NA 3.95E-10 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218320728 NA 2.96E-06 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218320728 NA 6.14E-06 mr1687_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218320728 NA 8.20E-20 mr1871_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251