\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0218179363:

Variant ID: vg0218179363 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 18179363
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, others allele: 0.00, population size: 53. )

Flanking Sequence (100 bp) in Reference Genome:


GAAGAGAAGAAAAGCTATACACAGCACATAGAGCATTACAGCTACATCTCATCCTTCTGACCCTTTTGCTTTACTCACCAGATCACCCCCTCGTGCTGAA[A/G]
CATTATCTTCTTCTTCAGTGATCATCTGCACTTGTAACTACAACAGGAACCCCCCTCTAGCAACGGATTTATGTATTGCTACAAGTCCATATAAGCGCTG

Reverse complement sequence

CAGCGCTTATATGGACTTGTAGCAATACATAAATCCGTTGCTAGAGGGGGGTTCCTGTTGTAGTTACAAGTGCAGATGATCACTGAAGAAGAAGATAATG[T/C]
TTCAGCACGAGGGGGTGATCTGGTGAGTAAAGCAAAAGGGTCAGAAGGATGAGATGTAGCTGTAATGCTCTATGTGCTGTGTATAGCTTTTCTTCTCTTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.50% 29.20% 0.30% 0.00% NA
All Indica  2759 78.70% 21.00% 0.33% 0.00% NA
All Japonica  1512 64.00% 35.90% 0.07% 0.00% NA
Aus  269 18.60% 81.40% 0.00% 0.00% NA
Indica I  595 81.30% 18.00% 0.67% 0.00% NA
Indica II  465 64.70% 34.80% 0.43% 0.00% NA
Indica III  913 85.00% 15.00% 0.00% 0.00% NA
Indica Intermediate  786 77.50% 22.10% 0.38% 0.00% NA
Temperate Japonica  767 95.70% 4.20% 0.13% 0.00% NA
Tropical Japonica  504 15.70% 84.30% 0.00% 0.00% NA
Japonica Intermediate  241 64.30% 35.70% 0.00% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 62.20% 33.30% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0218179363 A -> G LOC_Os02g30550.1 upstream_gene_variant ; 2498.0bp to feature; MODIFIER silent_mutation Average:67.712; most accessible tissue: Zhenshan97 root, score: 84.5 N N N N
vg0218179363 A -> G LOC_Os02g30540.1 downstream_gene_variant ; 993.0bp to feature; MODIFIER silent_mutation Average:67.712; most accessible tissue: Zhenshan97 root, score: 84.5 N N N N
vg0218179363 A -> G LOC_Os02g30540-LOC_Os02g30550 intergenic_region ; MODIFIER silent_mutation Average:67.712; most accessible tissue: Zhenshan97 root, score: 84.5 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0218179363 NA 1.24E-06 mr1236 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218179363 NA 3.46E-06 mr1295 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218179363 NA 6.91E-12 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218179363 4.38E-06 2.39E-08 mr1229_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218179363 NA 3.15E-07 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218179363 NA 1.10E-06 mr1257_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218179363 NA 4.59E-07 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218179363 NA 5.07E-07 mr1610_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218179363 NA 3.78E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218179363 NA 5.11E-12 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218179363 NA 4.82E-06 mr1897_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218179363 NA 3.52E-07 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218179363 NA 9.95E-09 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251