Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0218141493:

Variant ID: vg0218141493 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 18141493
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAAGAAATTTCTTTATTATGTCAGCTAGAAACGCTGAACATCATGCAGAATCAAAATTTCAGGATCCATGAACTAACTATAAATAGCATTACAAGTTAGT[A/G]
ACAGGAGAATTCACTGTTCCAGCCACCCAACAGCAACTATGAACACAGTTAGACACAATCAGACAATAAAGCACACTGCTCTCCAGTTCCCCACACTTAG

Reverse complement sequence

CTAAGTGTGGGGAACTGGAGAGCAGTGTGCTTTATTGTCTGATTGTGTCTAACTGTGTTCATAGTTGCTGTTGGGTGGCTGGAACAGTGAATTCTCCTGT[T/C]
ACTAACTTGTAATGCTATTTATAGTTAGTTCATGGATCCTGAAATTTTGATTCTGCATGATGTTCAGCGTTTCTAGCTGACATAATAAAGAAATTTCTTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.70%	21.30%	0.04%	0.00%	NA
All Indica	2759	99.10%	0.90%	0.07%	0.00%	NA
All Japonica	1512	41.60%	58.40%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.80%	1.20%	0.00%	0.00%	NA
Indica II	465	98.70%	1.30%	0.00%	0.00%	NA
Indica III	913	99.50%	0.40%	0.11%	0.00%	NA
Indica Intermediate	786	99.00%	0.90%	0.13%	0.00%	NA
Temperate Japonica	767	5.60%	94.40%	0.00%	0.00%	NA
Tropical Japonica	504	95.60%	4.40%	0.00%	0.00%	NA
Japonica Intermediate	241	43.20%	56.80%	0.00%	0.00%	NA
VI/Aromatic	96	17.70%	82.30%	0.00%	0.00%	NA
Intermediate	90	78.90%	21.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0218141493	A -> G	LOC_Os02g30450.1	upstream_gene_variant ; 3425.0bp to feature; MODIFIER	silent_mutation	Average:75.445; most accessible tissue: Minghui63 flag leaf, score: 87.725	N	N	N	N
vg0218141493	A -> G	LOC_Os02g30470.1	downstream_gene_variant ; 3771.0bp to feature; MODIFIER	silent_mutation	Average:75.445; most accessible tissue: Minghui63 flag leaf, score: 87.725	N	N	N	N
vg0218141493	A -> G	LOC_Os02g30460.1	intron_variant ; MODIFIER	silent_mutation	Average:75.445; most accessible tissue: Minghui63 flag leaf, score: 87.725	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0218141493	1.83E-06	NA	mr1022	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218141493	NA	4.84E-07	mr1022	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218141493	1.03E-07	NA	mr1023	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218141493	1.88E-08	NA	mr1079	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218141493	NA	5.46E-13	mr1079	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218141493	6.36E-08	NA	mr1142	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218141493	NA	2.37E-14	mr1142	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218141493	NA	3.51E-08	mr1243	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218141493	NA	1.44E-13	mr1334	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218141493	6.14E-07	NA	mr1489	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218141493	5.84E-06	NA	mr1491	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218141493	NA	4.55E-09	mr1563	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218141493	NA	6.26E-12	mr1667	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218141493	NA	1.07E-09	mr1769	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218141493	NA	5.67E-14	mr1769	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218141493	NA	1.23E-15	mr1830	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218141493	NA	8.35E-08	mr1862	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218141493	NA	5.12E-15	mr1933	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218141493	NA	8.05E-10	mr1093_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218141493	NA	9.69E-14	mr1217_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218141493	NA	3.15E-09	mr1235_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218141493	NA	1.29E-06	mr1257_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218141493	NA	3.71E-22	mr1304_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218141493	NA	6.07E-08	mr1364_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218141493	NA	1.47E-07	mr1599_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218141493	NA	1.22E-09	mr1769_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218141493	NA	6.75E-14	mr1769_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218141493	NA	5.93E-11	mr1830_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218141493	NA	1.00E-09	mr1916_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251