\
| Variant ID: vg0218106658 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 18106658 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.75, T: 0.26, others allele: 0.00, population size: 204. )
ATTGCATATCCATCTTTGAGATAATCGATACAGCACTCGACAACCTCTTCAGTACTATAACCCTCAACCATTGATCCCTCTGGATGTGCACGATTTCGAA[C/T]
GTAACCCTTCAAAACTGCCATGTAACGCTCGTATGACCACATTTGATGGAGATACAATGGGCCAAGTGCAACCATCTGCGGCACTATGTGAACAATGAGG
CCTCATTGTTCACATAGTGCCGCAGATGGTTGCACTTGGCCCATTGTATCTCCATCAAATGTGGTCATACGAGCGTTACATGGCAGTTTTGAAGGGTTAC[G/A]
TTCGAAATCGTGCACATCCAGAGGGATCAATGGTTGAGGGTTATAGTACTGAAGAGGTTGTCGAGTGCTGTATCGATTATCTCAAAGATGGATATGCAAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 41.90% | 24.10% | 21.92% | 12.04% | NA |
| All Indica | 2759 | 40.40% | 5.10% | 34.69% | 19.79% | NA |
| All Japonica | 1512 | 34.00% | 62.90% | 2.31% | 0.79% | NA |
| Aus | 269 | 84.80% | 3.70% | 10.78% | 0.74% | NA |
| Indica I | 595 | 31.80% | 3.90% | 41.18% | 23.19% | NA |
| Indica II | 465 | 45.60% | 5.60% | 22.80% | 26.02% | NA |
| Indica III | 913 | 47.00% | 6.00% | 35.82% | 11.17% | NA |
| Indica Intermediate | 786 | 36.40% | 4.60% | 35.50% | 23.54% | NA |
| Temperate Japonica | 767 | 4.30% | 94.50% | 0.52% | 0.65% | NA |
| Tropical Japonica | 504 | 77.20% | 17.90% | 4.17% | 0.79% | NA |
| Japonica Intermediate | 241 | 38.20% | 56.40% | 4.15% | 1.24% | NA |
| VI/Aromatic | 96 | 81.20% | 17.70% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 48.90% | 25.60% | 15.56% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0218106658 | C -> T | LOC_Os02g30400.1 | missense_variant ; p.Val518Ile; MODERATE | nonsynonymous_codon ; V518I | Average:19.263; most accessible tissue: Zhenshan97 flag leaf, score: 28.494 | benign |
0.622 |
TOLERATED | 0.06 |
| vg0218106658 | C -> DEL | LOC_Os02g30400.1 | N | frameshift_variant | Average:19.263; most accessible tissue: Zhenshan97 flag leaf, score: 28.494 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0218106658 | NA | 1.18E-09 | mr1018 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218106658 | NA | 5.08E-09 | mr1019 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218106658 | NA | 2.47E-07 | mr1022 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218106658 | 7.95E-07 | 3.70E-15 | mr1079 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218106658 | NA | 1.75E-15 | mr1142 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218106658 | 7.91E-06 | 1.47E-15 | mr1489 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218106658 | NA | 1.49E-14 | mr1491 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218106658 | NA | 1.37E-06 | mr1629 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218106658 | NA | 1.68E-16 | mr1769 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218106658 | NA | 1.23E-13 | mr1778 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218106658 | NA | 8.88E-06 | mr1780 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218106658 | NA | 2.83E-06 | mr1498_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218106658 | NA | 2.90E-14 | mr1769_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218106658 | NA | 3.09E-06 | mr1793_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218106658 | NA | 2.38E-09 | mr1916_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |