\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0218104924:

Variant ID: vg0218104924 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 18104924
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.90, T: 0.10, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:


GGGAGGAGGCCGCCCTCGCTTGGGGTCGAGCTGCCCCGACCCCCTCCACGTATCAGCCCACGTGTACAGGGTTAGGTGGGCGCGCCTAACGCCCACCTAA[T/C]
TGCATTTAAAGAACTCTATGCAACCACGCCATGCCACATTTAATGCGGCGTGCTGCGCATCTGACCGGTCTGTGACCGATTGAATGACCGATGGGACGGC

Reverse complement sequence

GCCGTCCCATCGGTCATTCAATCGGTCACAGACCGGTCAGATGCGCAGCACGCCGCATTAAATGTGGCATGGCGTGGTTGCATAGAGTTCTTTAAATGCA[A/G]
TTAGGTGGGCGTTAGGCGCGCCCACCTAACCCTGTACACGTGGGCTGATACGTGGAGGGGGTCGGGGCAGCTCGACCCCAAGCGAGGGCGGCCTCCTCCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.50% 21.10% 1.42% 0.91% NA
All Indica  2759 98.30% 0.70% 0.33% 0.62% NA
All Japonica  1512 36.10% 62.80% 0.86% 0.26% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.00% 0.70% 0.00% 1.34% NA
Indica II  465 97.00% 1.30% 0.65% 1.08% NA
Indica III  913 99.60% 0.30% 0.11% 0.00% NA
Indica Intermediate  786 98.00% 0.90% 0.64% 0.51% NA
Temperate Japonica  767 5.30% 94.50% 0.13% 0.00% NA
Tropical Japonica  504 80.60% 17.50% 1.79% 0.20% NA
Japonica Intermediate  241 41.10% 56.40% 1.24% 1.24% NA
VI/Aromatic  96 22.90% 13.50% 42.71% 20.83% NA
Intermediate  90 74.40% 18.90% 4.44% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0218104924 T -> DEL N N silent_mutation Average:63.298; most accessible tissue: Minghui63 young leaf, score: 83.419 N N N N
vg0218104924 T -> C LOC_Os02g30390.1 upstream_gene_variant ; 2473.0bp to feature; MODIFIER silent_mutation Average:63.298; most accessible tissue: Minghui63 young leaf, score: 83.419 N N N N
vg0218104924 T -> C LOC_Os02g30400.1 downstream_gene_variant ; 856.0bp to feature; MODIFIER silent_mutation Average:63.298; most accessible tissue: Minghui63 young leaf, score: 83.419 N N N N
vg0218104924 T -> C LOC_Os02g30390-LOC_Os02g30400 intergenic_region ; MODIFIER silent_mutation Average:63.298; most accessible tissue: Minghui63 young leaf, score: 83.419 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0218104924 NA 3.10E-07 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218104924 NA 4.40E-62 mr1142 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218104924 NA 2.28E-14 mr1142 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218104924 NA 1.00E-07 mr1243 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218104924 NA 1.51E-09 mr1277 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218104924 NA 4.70E-08 mr1423 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218104924 NA 1.32E-71 mr1489 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218104924 NA 1.75E-61 mr1491 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218104924 NA 9.82E-09 mr1563 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218104924 NA 1.61E-06 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218104924 NA 1.77E-09 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218104924 NA 3.27E-13 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218104924 NA 4.22E-74 mr1778 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218104924 NA 1.17E-24 mr1862 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218104924 NA 3.50E-08 mr1862 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218104924 NA 5.33E-06 mr1039_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218104924 NA 5.09E-06 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218104924 NA 1.57E-14 mr1217_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218104924 NA 4.99E-22 mr1304_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218104924 NA 5.96E-07 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218104924 NA 1.14E-10 mr1552_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218104924 NA 3.29E-09 mr1584_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218104924 NA 1.08E-07 mr1696_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218104924 NA 1.35E-11 mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218104924 NA 8.07E-06 mr1830_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218104924 NA 2.36E-06 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218104924 NA 1.03E-06 mr1873_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218104924 NA 6.22E-12 mr1879_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218104924 3.98E-06 5.26E-13 mr1916_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218104924 NA 4.37E-09 mr1942_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251