Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0218089895:

Variant ID: vg0218089895 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 18089895
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, G: 0.01, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


AAATGTCAAGCCGATGTGATTTCAGTTAAAAAAAAAAGAACAACTGAGATTTTATCCCTGATCATTCTCACTCATCTCTTCTATTCCCCATTCTCTCACC[C/G]
TCACTCTCTCTTTCTTTTCCTAACCTCTCACTCTCCCCATCTTGGCAGCGGTGGCCAACCTTGCAAGCATCGACGCCAGCATCACGGACACCAGCAGCTA

Reverse complement sequence

TAGCTGCTGGTGTCCGTGATGCTGGCGTCGATGCTTGCAAGGTTGGCCACCGCTGCCAAGATGGGGAGAGTGAGAGGTTAGGAAAAGAAAGAGAGAGTGA[G/C]
GGTGAGAGAATGGGGAATAGAAGAGATGAGTGAGAATGATCAGGGATAAAATCTCAGTTGTTCTTTTTTTTTTAACTGAAATCACATCGGCTTGACATTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.00% 34.90% 0.06% 0.00% NA
All Indica  2759 63.00% 37.00% 0.04% 0.00% NA
All Japonica  1512 68.00% 31.90% 0.13% 0.00% NA
Aus  269 85.10% 14.90% 0.00% 0.00% NA
Indica I  595 79.50% 20.50% 0.00% 0.00% NA
Indica II  465 80.00% 19.80% 0.22% 0.00% NA
Indica III  913 34.10% 65.90% 0.00% 0.00% NA
Indica Intermediate  786 73.90% 26.10% 0.00% 0.00% NA
Temperate Japonica  767 95.80% 4.00% 0.13% 0.00% NA
Tropical Japonica  504 28.00% 72.00% 0.00% 0.00% NA
Japonica Intermediate  241 63.10% 36.50% 0.41% 0.00% NA
VI/Aromatic  96 24.00% 76.00% 0.00% 0.00% NA
Intermediate  90 62.20% 37.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0218089895 C -> G LOC_Os02g30370.1 upstream_gene_variant ; 1632.0bp to feature; MODIFIER silent_mutation Average:82.109; most accessible tissue: Zhenshan97 panicle, score: 96.863 N N N N
vg0218089895 C -> G LOC_Os02g30380.1 upstream_gene_variant ; 2007.0bp to feature; MODIFIER silent_mutation Average:82.109; most accessible tissue: Zhenshan97 panicle, score: 96.863 N N N N
vg0218089895 C -> G LOC_Os02g30370-LOC_Os02g30380 intergenic_region ; MODIFIER silent_mutation Average:82.109; most accessible tissue: Zhenshan97 panicle, score: 96.863 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0218089895 C G 0.12 0.1 0.04 -0.02 0.07 0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0218089895 NA 6.11E-13 mr1079 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218089895 1.79E-06 9.69E-09 mr1138 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218089895 NA 3.12E-06 mr1169 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218089895 NA 7.34E-09 mr1563 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218089895 NA 5.88E-17 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218089895 NA 4.29E-06 mr1925 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218089895 4.44E-06 NA mr1138_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218089895 3.72E-07 4.97E-10 mr1138_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218089895 NA 4.46E-08 mr1354_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218089895 NA 1.02E-06 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218089895 NA 5.71E-16 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218089895 NA 6.58E-10 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251