\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0218080379:

Variant ID: vg0218080379 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 18080379
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 124. )

Flanking Sequence (100 bp) in Reference Genome:


AGGGAGTATCACACAAGAGTTCATAATATAGATTTATTTATTTATACGATTACACCACCACACTCACACCCTTAACGCAGGATGTTAGATATGGAAACCA[G/A]
CAACACATCTTTAATCTCACTAATTTCCTATTGAAAATCTACCTCTATGTGCACAATATTCGTATGCACTAGAGTTATTTTGGAAAAGACGGATTAGGGT

Reverse complement sequence

ACCCTAATCCGTCTTTTCCAAAATAACTCTAGTGCATACGAATATTGTGCACATAGAGGTAGATTTTCAATAGGAAATTAGTGAGATTAAAGATGTGTTG[C/T]
TGGTTTCCATATCTAACATCCTGCGTTAAGGGTGTGAGTGTGGTGGTGTAATCGTATAAATAAATAAATCTATATTATGAACTCTTGTGTGATACTCCCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.60% 35.30% 0.11% 0.00% NA
All Indica  2759 62.70% 37.20% 0.14% 0.00% NA
All Japonica  1512 67.90% 32.10% 0.00% 0.00% NA
Aus  269 81.80% 18.20% 0.00% 0.00% NA
Indica I  595 79.50% 20.20% 0.34% 0.00% NA
Indica II  465 79.40% 20.20% 0.43% 0.00% NA
Indica III  913 34.00% 66.00% 0.00% 0.00% NA
Indica Intermediate  786 73.50% 26.50% 0.00% 0.00% NA
Temperate Japonica  767 95.70% 4.30% 0.00% 0.00% NA
Tropical Japonica  504 28.00% 72.00% 0.00% 0.00% NA
Japonica Intermediate  241 63.10% 36.90% 0.00% 0.00% NA
VI/Aromatic  96 24.00% 75.00% 1.04% 0.00% NA
Intermediate  90 61.10% 38.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0218080379 G -> A LOC_Os02g30350.1 downstream_gene_variant ; 2239.0bp to feature; MODIFIER silent_mutation Average:33.429; most accessible tissue: Callus, score: 61.811 N N N N
vg0218080379 G -> A LOC_Os02g30360.1 downstream_gene_variant ; 2128.0bp to feature; MODIFIER silent_mutation Average:33.429; most accessible tissue: Callus, score: 61.811 N N N N
vg0218080379 G -> A LOC_Os02g30370.1 downstream_gene_variant ; 4195.0bp to feature; MODIFIER silent_mutation Average:33.429; most accessible tissue: Callus, score: 61.811 N N N N
vg0218080379 G -> A LOC_Os02g30350-LOC_Os02g30360 intergenic_region ; MODIFIER silent_mutation Average:33.429; most accessible tissue: Callus, score: 61.811 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0218080379 NA 6.11E-13 mr1079 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218080379 8.55E-07 1.03E-08 mr1138 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218080379 NA 8.51E-06 mr1169 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218080379 NA 7.34E-09 mr1563 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218080379 NA 5.88E-17 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218080379 NA 4.29E-06 mr1925 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218080379 NA 2.18E-06 mr1993 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218080379 5.63E-06 NA mr1138_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218080379 8.80E-07 1.74E-09 mr1138_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218080379 NA 3.90E-06 mr1346_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218080379 NA 7.23E-08 mr1354_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218080379 NA 7.83E-06 mr1428_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218080379 NA 1.02E-06 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218080379 NA 5.71E-16 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218080379 NA 6.58E-10 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251