\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0218064697:

Variant ID: vg0218064697 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 18064697
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, G: 0.01, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:


AACTCGGTCTCTTCTGGATAAGATTCCTTTAGTAGATCAATTTCCTTAATCGAATATAGCAAGAATCCGACAACTGACGACTTGATAACTCTCATCGGCT[A/G]
ATCTCAGGACTTCGAAGCCGATGATTACTCTAGGCTTACCAAATTTACATTATTGCTTCTAACCAATGACCTTATTACCTTAAGACATTCGGGCAGCTTG

Reverse complement sequence

CAAGCTGCCCGAATGTCTTAAGGTAATAAGGTCATTGGTTAGAAGCAATAATGTAAATTTGGTAAGCCTAGAGTAATCATCGGCTTCGAAGTCCTGAGAT[T/C]
AGCCGATGAGAGTTATCAAGTCGTCAGTTGTCGGATTCTTGCTATATTCGATTAAGGAAATTGATCTACTAAAGGAATCTTATCCAGAAGAGACCGAGTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.00% 33.50% 0.30% 1.16% NA
All Indica  2759 62.20% 37.40% 0.22% 0.18% NA
All Japonica  1512 68.40% 31.30% 0.13% 0.13% NA
Aus  269 81.80% 18.20% 0.00% 0.00% NA
Indica I  595 79.70% 20.00% 0.34% 0.00% NA
Indica II  465 79.60% 20.00% 0.22% 0.22% NA
Indica III  913 32.30% 67.50% 0.11% 0.11% NA
Indica Intermediate  786 73.50% 25.80% 0.25% 0.38% NA
Temperate Japonica  767 96.10% 3.80% 0.13% 0.00% NA
Tropical Japonica  504 28.40% 71.60% 0.00% 0.00% NA
Japonica Intermediate  241 63.90% 34.90% 0.41% 0.83% NA
VI/Aromatic  96 52.10% 2.10% 2.08% 43.75% NA
Intermediate  90 57.80% 31.10% 4.44% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0218064697 A -> G LOC_Os02g30330.1 upstream_gene_variant ; 3559.0bp to feature; MODIFIER silent_mutation Average:76.718; most accessible tissue: Minghui63 panicle, score: 89.175 N N N N
vg0218064697 A -> G LOC_Os02g30320.1 downstream_gene_variant ; 4584.0bp to feature; MODIFIER silent_mutation Average:76.718; most accessible tissue: Minghui63 panicle, score: 89.175 N N N N
vg0218064697 A -> G LOC_Os02g30320-LOC_Os02g30330 intergenic_region ; MODIFIER silent_mutation Average:76.718; most accessible tissue: Minghui63 panicle, score: 89.175 N N N N
vg0218064697 A -> DEL N N silent_mutation Average:76.718; most accessible tissue: Minghui63 panicle, score: 89.175 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0218064697 9.66E-08 1.10E-11 mr1138 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218064697 2.13E-06 1.09E-08 mr1138 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218064697 NA 2.99E-06 mr1169 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218064697 NA 1.47E-09 mr1563 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218064697 NA 1.09E-06 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218064697 NA 1.04E-14 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218064697 NA 9.67E-07 mr1993 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218064697 2.07E-08 3.49E-13 mr1138_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218064697 2.02E-06 1.83E-09 mr1138_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218064697 NA 9.36E-11 mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218064697 NA 1.03E-07 mr1354_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218064697 NA 1.64E-06 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218064697 NA 8.89E-10 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251