\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0218063030:

Variant ID: vg0218063030 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 18063030
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.82, C: 0.18, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


CCGAGCTAGCTAGCTTGTTATCCAGTATCCACCTCTAACCAAGAAGAAAATAATTTTATTTTATTAATAGATCCAAGAATAAAAAATAGTAATCATAAAA[T/C]
TATATATATAATCTATGCTAACATTTCATTTGTTTCACTACTTATTTTGTTAATTTAATAATATTGAAATTCGAAATTAATAACTAGACAATTCAGAATT

Reverse complement sequence

AATTCTGAATTGTCTAGTTATTAATTTCGAATTTCAATATTATTAAATTAACAAAATAAGTAGTGAAACAAATGAAATGTTAGCATAGATTATATATATA[A/G]
TTTTATGATTACTATTTTTTATTCTTGGATCTATTAATAAAATAAAATTATTTTCTTCTTGGTTAGAGGTGGATACTGGATAACAAGCTAGCTAGCTCGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.20% 43.00% 0.72% 1.14% NA
All Indica  2759 38.50% 61.10% 0.22% 0.11% NA
All Japonica  1512 94.40% 5.40% 0.13% 0.13% NA
Aus  269 18.20% 81.80% 0.00% 0.00% NA
Indica I  595 21.20% 78.50% 0.34% 0.00% NA
Indica II  465 21.70% 78.30% 0.00% 0.00% NA
Indica III  913 68.30% 31.40% 0.11% 0.11% NA
Indica Intermediate  786 27.00% 72.40% 0.38% 0.25% NA
Temperate Japonica  767 98.60% 1.40% 0.00% 0.00% NA
Tropical Japonica  504 89.50% 10.50% 0.00% 0.00% NA
Japonica Intermediate  241 91.30% 7.10% 0.83% 0.83% NA
VI/Aromatic  96 17.70% 11.50% 26.04% 44.79% NA
Intermediate  90 56.70% 35.60% 1.11% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0218063030 T -> DEL N N silent_mutation Average:47.057; most accessible tissue: Callus, score: 80.254 N N N N
vg0218063030 T -> C LOC_Os02g30320.1 downstream_gene_variant ; 2917.0bp to feature; MODIFIER silent_mutation Average:47.057; most accessible tissue: Callus, score: 80.254 N N N N
vg0218063030 T -> C LOC_Os02g30320-LOC_Os02g30330 intergenic_region ; MODIFIER silent_mutation Average:47.057; most accessible tissue: Callus, score: 80.254 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0218063030 2.11E-07 9.42E-16 mr1138 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218063030 2.60E-06 1.80E-08 mr1138 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218063030 NA 3.65E-06 mr1169 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218063030 NA 7.88E-08 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218063030 1.20E-07 5.28E-18 mr1138_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218063030 NA 6.81E-09 mr1138_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218063030 NA 1.68E-09 mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218063030 NA 1.98E-06 mr1354_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218063030 NA 1.98E-06 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251