\
| Variant ID: vg0218063030 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 18063030 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.82, C: 0.18, others allele: 0.00, population size: 105. )
CCGAGCTAGCTAGCTTGTTATCCAGTATCCACCTCTAACCAAGAAGAAAATAATTTTATTTTATTAATAGATCCAAGAATAAAAAATAGTAATCATAAAA[T/C]
TATATATATAATCTATGCTAACATTTCATTTGTTTCACTACTTATTTTGTTAATTTAATAATATTGAAATTCGAAATTAATAACTAGACAATTCAGAATT
AATTCTGAATTGTCTAGTTATTAATTTCGAATTTCAATATTATTAAATTAACAAAATAAGTAGTGAAACAAATGAAATGTTAGCATAGATTATATATATA[A/G]
TTTTATGATTACTATTTTTTATTCTTGGATCTATTAATAAAATAAAATTATTTTCTTCTTGGTTAGAGGTGGATACTGGATAACAAGCTAGCTAGCTCGG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.20% | 43.00% | 0.72% | 1.14% | NA |
| All Indica | 2759 | 38.50% | 61.10% | 0.22% | 0.11% | NA |
| All Japonica | 1512 | 94.40% | 5.40% | 0.13% | 0.13% | NA |
| Aus | 269 | 18.20% | 81.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 21.20% | 78.50% | 0.34% | 0.00% | NA |
| Indica II | 465 | 21.70% | 78.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 68.30% | 31.40% | 0.11% | 0.11% | NA |
| Indica Intermediate | 786 | 27.00% | 72.40% | 0.38% | 0.25% | NA |
| Temperate Japonica | 767 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 89.50% | 10.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 91.30% | 7.10% | 0.83% | 0.83% | NA |
| VI/Aromatic | 96 | 17.70% | 11.50% | 26.04% | 44.79% | NA |
| Intermediate | 90 | 56.70% | 35.60% | 1.11% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0218063030 | T -> DEL | N | N | silent_mutation | Average:47.057; most accessible tissue: Callus, score: 80.254 | N | N | N | N |
| vg0218063030 | T -> C | LOC_Os02g30320.1 | downstream_gene_variant ; 2917.0bp to feature; MODIFIER | silent_mutation | Average:47.057; most accessible tissue: Callus, score: 80.254 | N | N | N | N |
| vg0218063030 | T -> C | LOC_Os02g30320-LOC_Os02g30330 | intergenic_region ; MODIFIER | silent_mutation | Average:47.057; most accessible tissue: Callus, score: 80.254 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0218063030 | 2.11E-07 | 9.42E-16 | mr1138 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218063030 | 2.60E-06 | 1.80E-08 | mr1138 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218063030 | NA | 3.65E-06 | mr1169 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218063030 | NA | 7.88E-08 | mr1354 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218063030 | 1.20E-07 | 5.28E-18 | mr1138_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218063030 | NA | 6.81E-09 | mr1138_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218063030 | NA | 1.68E-09 | mr1354_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218063030 | NA | 1.98E-06 | mr1354_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218063030 | NA | 1.98E-06 | mr1559_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |