Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0218063030:

Variant ID: vg0218063030 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 18063030
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.82, C: 0.18, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:

CCGAGCTAGCTAGCTTGTTATCCAGTATCCACCTCTAACCAAGAAGAAAATAATTTTATTTTATTAATAGATCCAAGAATAAAAAATAGTAATCATAAAA[T/C]
TATATATATAATCTATGCTAACATTTCATTTGTTTCACTACTTATTTTGTTAATTTAATAATATTGAAATTCGAAATTAATAACTAGACAATTCAGAATT

Reverse complement sequence

AATTCTGAATTGTCTAGTTATTAATTTCGAATTTCAATATTATTAAATTAACAAAATAAGTAGTGAAACAAATGAAATGTTAGCATAGATTATATATATA[A/G]
TTTTATGATTACTATTTTTTATTCTTGGATCTATTAATAAAATAAAATTATTTTCTTCTTGGTTAGAGGTGGATACTGGATAACAAGCTAGCTAGCTCGG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.20%	43.00%	0.72%	1.14%	NA
All Indica	2759	38.50%	61.10%	0.22%	0.11%	NA
All Japonica	1512	94.40%	5.40%	0.13%	0.13%	NA
Aus	269	18.20%	81.80%	0.00%	0.00%	NA
Indica I	595	21.20%	78.50%	0.34%	0.00%	NA
Indica II	465	21.70%	78.30%	0.00%	0.00%	NA
Indica III	913	68.30%	31.40%	0.11%	0.11%	NA
Indica Intermediate	786	27.00%	72.40%	0.38%	0.25%	NA
Temperate Japonica	767	98.60%	1.40%	0.00%	0.00%	NA
Tropical Japonica	504	89.50%	10.50%	0.00%	0.00%	NA
Japonica Intermediate	241	91.30%	7.10%	0.83%	0.83%	NA
VI/Aromatic	96	17.70%	11.50%	26.04%	44.79%	NA
Intermediate	90	56.70%	35.60%	1.11%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0218063030	T -> DEL	N	N	silent_mutation	Average:47.057; most accessible tissue: Callus, score: 80.254	N	N	N	N
vg0218063030	T -> C	LOC_Os02g30320.1	downstream_gene_variant ; 2917.0bp to feature; MODIFIER	silent_mutation	Average:47.057; most accessible tissue: Callus, score: 80.254	N	N	N	N
vg0218063030	T -> C	LOC_Os02g30320-LOC_Os02g30330	intergenic_region ; MODIFIER	silent_mutation	Average:47.057; most accessible tissue: Callus, score: 80.254	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0218063030	2.11E-07	9.42E-16	mr1138	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218063030	2.60E-06	1.80E-08	mr1138	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218063030	NA	3.65E-06	mr1169	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218063030	NA	7.88E-08	mr1354	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218063030	1.20E-07	5.28E-18	mr1138_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218063030	NA	6.81E-09	mr1138_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218063030	NA	1.68E-09	mr1354_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218063030	NA	1.98E-06	mr1354_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218063030	NA	1.98E-06	mr1559_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251