\
| Variant ID: vg0218033645 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 18033645 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 263. )
GGTCAGACCAGCGTGTATCGAGCAGTCAGACCGGCTAGCCTATGGTCTGACCGGCTGATTCTGTGTCGGTTTCGGTTTCGGGTTGGTTTGTTGGATATCC[G/A]
TGGATAATTCATGTTTATGACTTCAAGATAGATACTATGCGTATGTAATACTGCTATGTGCTAACAATGAGTCAAGTTGGTAAGAACTTGTACTTGGATA
TATCCAAGTACAAGTTCTTACCAACTTGACTCATTGTTAGCACATAGCAGTATTACATACGCATAGTATCTATCTTGAAGTCATAAACATGAATTATCCA[C/T]
GGATATCCAACAAACCAACCCGAAACCGAAACCGACACAGAATCAGCCGGTCAGACCATAGGCTAGCCGGTCTGACTGCTCGATACACGCTGGTCTGACC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.80% | 34.00% | 0.13% | 0.15% | NA |
| All Indica | 2759 | 62.00% | 37.60% | 0.18% | 0.25% | NA |
| All Japonica | 1512 | 67.80% | 32.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 81.00% | 19.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 79.20% | 20.70% | 0.17% | 0.00% | NA |
| Indica II | 465 | 80.20% | 19.40% | 0.00% | 0.43% | NA |
| Indica III | 913 | 31.80% | 67.70% | 0.33% | 0.22% | NA |
| Indica Intermediate | 786 | 73.30% | 26.20% | 0.13% | 0.38% | NA |
| Temperate Japonica | 767 | 95.20% | 4.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 28.80% | 71.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 62.20% | 37.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 66.70% | 32.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0218033645 | G -> A | LOC_Os02g30300-LOC_Os02g30310 | intergenic_region ; MODIFIER | silent_mutation | Average:66.643; most accessible tissue: Zhenshan97 panicle, score: 80.486 | N | N | N | N |
| vg0218033645 | G -> DEL | N | N | silent_mutation | Average:66.643; most accessible tissue: Zhenshan97 panicle, score: 80.486 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0218033645 | 2.52E-06 | NA | mr1138 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218033645 | 3.50E-06 | 4.86E-08 | mr1138 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218033645 | NA | 7.82E-06 | mr1169 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218033645 | NA | 5.12E-06 | mr1295 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218033645 | NA | 1.12E-10 | mr1563 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218033645 | NA | 4.57E-15 | mr1769 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218033645 | 2.06E-08 | 1.85E-13 | mr1138_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218033645 | 1.28E-06 | 3.66E-09 | mr1138_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218033645 | NA | 8.74E-06 | mr1138_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218033645 | NA | 1.78E-11 | mr1354_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218033645 | NA | 8.96E-08 | mr1354_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218033645 | NA | 4.11E-14 | mr1769_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218033645 | NA | 3.84E-09 | mr1916_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |