\
| Variant ID: vg0218008797 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 18008797 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTACATACAAGTTACAGTGTAATTATACTACGATTGTACTATAATTACATCTGTCAAATTTTCAGAAGAAAATTTGTCGACAAATGTATAGGTGGTCCCG[T/G]
CCTTTTTTAGCCAACTTTTTAGTTGTTCATCGGTGTTCCGCGCGTGCCAACACTGTAGATTTTTTAGAGAGGAAATAATAACTGTAGATGGTTCCAGAAC
GTTCTGGAACCATCTACAGTTATTATTTCCTCTCTAAAAAATCTACAGTGTTGGCACGCGCGGAACACCGATGAACAACTAAAAAGTTGGCTAAAAAAGG[A/C]
CGGGACCACCTATACATTTGTCGACAAATTTTCTTCTGAAAATTTGACAGATGTAATTATAGTACAATCGTAGTATAATTACACTGTAACTTGTATGTAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.10% | 8.30% | 2.60% | 0.00% | NA |
| All Indica | 2759 | 99.70% | 0.10% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 66.90% | 25.30% | 7.80% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.20% | 0.17% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.60% | 0.22% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.00% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 36.40% | 48.90% | 14.73% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 94.60% | 3.30% | 2.07% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 6.70% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0218008797 | T -> G | LOC_Os02g30270.1 | upstream_gene_variant ; 4808.0bp to feature; MODIFIER | silent_mutation | Average:59.616; most accessible tissue: Zhenshan97 flower, score: 75.657 | N | N | N | N |
| vg0218008797 | T -> G | LOC_Os02g30280.1 | downstream_gene_variant ; 2421.0bp to feature; MODIFIER | silent_mutation | Average:59.616; most accessible tissue: Zhenshan97 flower, score: 75.657 | N | N | N | N |
| vg0218008797 | T -> G | LOC_Os02g30290.1 | downstream_gene_variant ; 2620.0bp to feature; MODIFIER | silent_mutation | Average:59.616; most accessible tissue: Zhenshan97 flower, score: 75.657 | N | N | N | N |
| vg0218008797 | T -> G | LOC_Os02g30280-LOC_Os02g30290 | intergenic_region ; MODIFIER | silent_mutation | Average:59.616; most accessible tissue: Zhenshan97 flower, score: 75.657 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0218008797 | 2.60E-06 | NA | mr1926 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218008797 | NA | 1.33E-06 | mr1355_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218008797 | NA | 6.76E-06 | mr1627_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218008797 | NA | 9.45E-06 | mr1899_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |