\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0217984068:

Variant ID: vg0217984068 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 17984068
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.77, T: 0.23, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


AACACGCGCCACACTAGTCTAGCATGTGATACTCTCTCGTCGTGACACATTCTCCTTCCATATATAATACTTAACATCAATATAAATGTGAGAAATGATA[G/T]
AATGACTTACATTGTGAAACGGAGGGAGTATGTTGAAAAATTGAGTTACCCTAGCATATAATTGGTGTTACATTGATGACAGAATCCATTATATGCCATT

Reverse complement sequence

AATGGCATATAATGGATTCTGTCATCAATGTAACACCAATTATATGCTAGGGTAACTCAATTTTTCAACATACTCCCTCCGTTTCACAATGTAAGTCATT[C/A]
TATCATTTCTCACATTTATATTGATGTTAAGTATTATATATGGAAGGAGAATGTGTCACGACGAGAGAGTATCACATGCTAGACTAGTGTGGCGCGTGTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.80% 34.70% 0.17% 0.25% NA
All Indica  2759 49.30% 50.10% 0.25% 0.40% NA
All Japonica  1512 96.70% 3.30% 0.00% 0.00% NA
Aus  269 34.60% 65.10% 0.37% 0.00% NA
Indica I  595 36.50% 63.20% 0.17% 0.17% NA
Indica II  465 24.50% 74.40% 0.86% 0.22% NA
Indica III  913 79.10% 20.50% 0.11% 0.33% NA
Indica Intermediate  786 38.90% 60.20% 0.13% 0.76% NA
Temperate Japonica  767 98.60% 1.40% 0.00% 0.00% NA
Tropical Japonica  504 94.60% 5.40% 0.00% 0.00% NA
Japonica Intermediate  241 95.00% 5.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 61.10% 37.80% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0217984068 G -> T LOC_Os02g30240.1 upstream_gene_variant ; 1533.0bp to feature; MODIFIER silent_mutation Average:45.127; most accessible tissue: Callus, score: 77.241 N N N N
vg0217984068 G -> T LOC_Os02g30250.1 upstream_gene_variant ; 631.0bp to feature; MODIFIER silent_mutation Average:45.127; most accessible tissue: Callus, score: 77.241 N N N N
vg0217984068 G -> T LOC_Os02g30230.1 downstream_gene_variant ; 2961.0bp to feature; MODIFIER silent_mutation Average:45.127; most accessible tissue: Callus, score: 77.241 N N N N
vg0217984068 G -> T LOC_Os02g30230.2 downstream_gene_variant ; 2961.0bp to feature; MODIFIER silent_mutation Average:45.127; most accessible tissue: Callus, score: 77.241 N N N N
vg0217984068 G -> T LOC_Os02g30230.3 downstream_gene_variant ; 2961.0bp to feature; MODIFIER silent_mutation Average:45.127; most accessible tissue: Callus, score: 77.241 N N N N
vg0217984068 G -> T LOC_Os02g30240-LOC_Os02g30250 intergenic_region ; MODIFIER silent_mutation Average:45.127; most accessible tissue: Callus, score: 77.241 N N N N
vg0217984068 G -> DEL N N silent_mutation Average:45.127; most accessible tissue: Callus, score: 77.241 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0217984068 NA 4.68E-11 mr1138 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217984068 1.28E-06 5.74E-09 mr1138 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217984068 NA 1.54E-07 mr1169 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217984068 NA 1.58E-06 mr1251 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217984068 NA 3.75E-06 mr1257 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217984068 NA 5.17E-06 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217984068 5.41E-06 5.41E-06 mr1379 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217984068 NA 6.60E-06 mr1423 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217984068 NA 2.17E-06 mr1435 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217984068 NA 4.33E-09 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217984068 NA 9.86E-06 mr1559 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217984068 3.47E-06 2.50E-12 mr1138_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217984068 NA 5.40E-07 mr1138_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217984068 NA 7.28E-07 mr1354_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217984068 NA 4.97E-13 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217984068 NA 3.13E-06 mr1379_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217984068 NA 9.80E-12 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217984068 NA 1.37E-07 mr1559_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217984068 NA 9.30E-06 mr1649_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217984068 NA 1.26E-06 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217984068 6.94E-09 NA mr1855_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217984068 8.14E-07 6.62E-07 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251