Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0217984068:

Variant ID: vg0217984068 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 17984068
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.77, T: 0.23, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:

AACACGCGCCACACTAGTCTAGCATGTGATACTCTCTCGTCGTGACACATTCTCCTTCCATATATAATACTTAACATCAATATAAATGTGAGAAATGATA[G/T]
AATGACTTACATTGTGAAACGGAGGGAGTATGTTGAAAAATTGAGTTACCCTAGCATATAATTGGTGTTACATTGATGACAGAATCCATTATATGCCATT

Reverse complement sequence

AATGGCATATAATGGATTCTGTCATCAATGTAACACCAATTATATGCTAGGGTAACTCAATTTTTCAACATACTCCCTCCGTTTCACAATGTAAGTCATT[C/A]
TATCATTTCTCACATTTATATTGATGTTAAGTATTATATATGGAAGGAGAATGTGTCACGACGAGAGAGTATCACATGCTAGACTAGTGTGGCGCGTGTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.80%	34.70%	0.17%	0.25%	NA
All Indica	2759	49.30%	50.10%	0.25%	0.40%	NA
All Japonica	1512	96.70%	3.30%	0.00%	0.00%	NA
Aus	269	34.60%	65.10%	0.37%	0.00%	NA
Indica I	595	36.50%	63.20%	0.17%	0.17%	NA
Indica II	465	24.50%	74.40%	0.86%	0.22%	NA
Indica III	913	79.10%	20.50%	0.11%	0.33%	NA
Indica Intermediate	786	38.90%	60.20%	0.13%	0.76%	NA
Temperate Japonica	767	98.60%	1.40%	0.00%	0.00%	NA
Tropical Japonica	504	94.60%	5.40%	0.00%	0.00%	NA
Japonica Intermediate	241	95.00%	5.00%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	61.10%	37.80%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0217984068	G -> T	LOC_Os02g30240.1	upstream_gene_variant ; 1533.0bp to feature; MODIFIER	silent_mutation	Average:45.127; most accessible tissue: Callus, score: 77.241	N	N	N	N
vg0217984068	G -> T	LOC_Os02g30250.1	upstream_gene_variant ; 631.0bp to feature; MODIFIER	silent_mutation	Average:45.127; most accessible tissue: Callus, score: 77.241	N	N	N	N
vg0217984068	G -> T	LOC_Os02g30230.1	downstream_gene_variant ; 2961.0bp to feature; MODIFIER	silent_mutation	Average:45.127; most accessible tissue: Callus, score: 77.241	N	N	N	N
vg0217984068	G -> T	LOC_Os02g30230.2	downstream_gene_variant ; 2961.0bp to feature; MODIFIER	silent_mutation	Average:45.127; most accessible tissue: Callus, score: 77.241	N	N	N	N
vg0217984068	G -> T	LOC_Os02g30230.3	downstream_gene_variant ; 2961.0bp to feature; MODIFIER	silent_mutation	Average:45.127; most accessible tissue: Callus, score: 77.241	N	N	N	N
vg0217984068	G -> T	LOC_Os02g30240-LOC_Os02g30250	intergenic_region ; MODIFIER	silent_mutation	Average:45.127; most accessible tissue: Callus, score: 77.241	N	N	N	N
vg0217984068	G -> DEL	N	N	silent_mutation	Average:45.127; most accessible tissue: Callus, score: 77.241	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0217984068	NA	4.68E-11	mr1138	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217984068	1.28E-06	5.74E-09	mr1138	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217984068	NA	1.54E-07	mr1169	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217984068	NA	1.58E-06	mr1251	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217984068	NA	3.75E-06	mr1257	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217984068	NA	5.17E-06	mr1354	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217984068	5.41E-06	5.41E-06	mr1379	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217984068	NA	6.60E-06	mr1423	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217984068	NA	2.17E-06	mr1435	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217984068	NA	4.33E-09	mr1559	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217984068	NA	9.86E-06	mr1559	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217984068	3.47E-06	2.50E-12	mr1138_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217984068	NA	5.40E-07	mr1138_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217984068	NA	7.28E-07	mr1354_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217984068	NA	4.97E-13	mr1379_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217984068	NA	3.13E-06	mr1379_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217984068	NA	9.80E-12	mr1559_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217984068	NA	1.37E-07	mr1559_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217984068	NA	9.30E-06	mr1649_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217984068	NA	1.26E-06	mr1807_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217984068	6.94E-09	NA	mr1855_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217984068	8.14E-07	6.62E-07	mr1855_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251