\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0217956643:

Variant ID: vg0217956643 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 17956643
Reference Allele: AAAAGTCTTATAATCTAAAAGTAGGTAGAlternative Allele: A,GAAAGTCTTATAATCTAAAAGTAGGTAG
Primary Allele: ASecondary Allele: AAAAGTCTTATAATCTAAAA GTAGGTAG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AACTAGCATAATCAAACAAACTACTTCATTCGTTTCATATTATAAGACTTTCTAGCATTATCCACATTCATTAGTATCTATATAAATATAGATAATGCTA[AAAAGTCTTATAATCTAAAAGTAGGTAG/A,GAAAGTCTTATAATCTAAAAGTAGGTAG]
AACAAGCGAACAGTATTTTATTTTATCTAGGAAAGGCGCATAAGAAGAAGTGAAGAACTTTTTTGGTTATATAATGCAATTGACCAGTATTATTACTAGT

Reverse complement sequence

ACTAGTAATAATACTGGTCAATTGCATTATATAACCAAAAAAGTTCTTCACTTCTTCTTATGCGCCTTTCCTAGATAAAATAAAATACTGTTCGCTTGTT[CTACCTACTTTTAGATTATAAGACTTTT/T,CTACCTACTTTTAGATTATAAGACTTTC]
TAGCATTATCTATATTTATATAGATACTAATGAATGTGGATAATGCTAGAAAGTCTTATAATATGAAACGAATGAAGTAGTTTGTTTGATTATGCTAGTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of AAAAGTCTTATAATCTAAAA GTAGGTAG(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 17.80% 17.50% 0.85% 62.42% GAAAGTCTTATAATCTAAAAGTAGGTAG: 1.50%
All Indica  2759 5.80% 0.50% 0.69% 90.97% GAAAGTCTTATAATCTAAAAGTAGGTAG: 2.07%
All Japonica  1512 43.40% 52.40% 0.46% 3.51% GAAAGTCTTATAATCTAAAAGTAGGTAG: 0.20%
Aus  269 0.00% 0.70% 4.83% 91.45% GAAAGTCTTATAATCTAAAAGTAGGTAG: 2.97%
Indica I  595 0.00% 0.30% 1.01% 95.29% GAAAGTCTTATAATCTAAAAGTAGGTAG: 3.36%
Indica II  465 10.50% 0.60% 0.43% 85.16% GAAAGTCTTATAATCTAAAAGTAGGTAG: 3.23%
Indica III  913 9.00% 0.20% 0.55% 90.25% NA
Indica Intermediate  786 3.70% 0.80% 0.76% 91.98% GAAAGTCTTATAATCTAAAAGTAGGTAG: 2.80%
Temperate Japonica  767 5.30% 93.20% 0.00% 1.43% NA
Tropical Japonica  504 89.30% 4.00% 0.99% 5.16% GAAAGTCTTATAATCTAAAAGTAGGTAG: 0.60%
Japonica Intermediate  241 68.50% 24.10% 0.83% 6.64% NA
VI/Aromatic  96 4.20% 4.20% 0.00% 90.62% GAAAGTCTTATAATCTAAAAGTAGGTAG: 1.04%
Intermediate  90 21.10% 15.60% 1.11% 60.00% GAAAGTCTTATAATCTAAAAGTAGGTAG: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0217956643 AAAAGTCTTATAATCTAAAAGTAGGTAG -> A LOC_Os02g30210.1 downstream_gene_variant ; 1852.0bp to feature; MODIFIER silent_mutation Average:59.603; most accessible tissue: Zhenshan97 flower, score: 69.089 N N N N
vg0217956643 AAAAGTCTTATAATCTAAAAGTAGGTAG -> A LOC_Os02g30210.2 downstream_gene_variant ; 1852.0bp to feature; MODIFIER silent_mutation Average:59.603; most accessible tissue: Zhenshan97 flower, score: 69.089 N N N N
vg0217956643 AAAAGTCTTATAATCTAAAAGTAGGTAG -> A LOC_Os02g30200.1 intron_variant ; MODIFIER silent_mutation Average:59.603; most accessible tissue: Zhenshan97 flower, score: 69.089 N N N N
vg0217956643 AAAAGTCTTATAATCTAAAAGTAGGTAG -> GAAAGTCTTATAATCTAAAAGTAGGTAG LOC_Os02g30210.1 downstream_gene_variant ; 1853.0bp to feature; MODIFIER silent_mutation Average:59.603; most accessible tissue: Zhenshan97 flower, score: 69.089 N N N N
vg0217956643 AAAAGTCTTATAATCTAAAAGTAGGTAG -> GAAAGTCTTATAATCTAAAAGTAGGTAG LOC_Os02g30210.2 downstream_gene_variant ; 1853.0bp to feature; MODIFIER silent_mutation Average:59.603; most accessible tissue: Zhenshan97 flower, score: 69.089 N N N N
vg0217956643 AAAAGTCTTATAATCTAAAAGTAGGTAG -> GAAAGTCTTATAATCTAAAAGTAGGTAG LOC_Os02g30200.1 intron_variant ; MODIFIER silent_mutation Average:59.603; most accessible tissue: Zhenshan97 flower, score: 69.089 N N N N
vg0217956643 AAAAGTCTTATAATCTAAAAGTAGGTAG -> DEL N N silent_mutation Average:59.603; most accessible tissue: Zhenshan97 flower, score: 69.089 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0217956643 2.00E-06 NA mr1036 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643 2.86E-06 1.85E-43 mr1089 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643 3.32E-06 9.92E-47 mr1093 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643 NA 2.96E-09 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643 NA 3.68E-26 mr1223 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643 NA 1.13E-40 mr1235 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643 NA 6.66E-34 mr1243 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643 NA 4.48E-17 mr1253 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643 NA 4.58E-15 mr1276 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643 NA 1.64E-12 mr1326 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643 NA 3.80E-35 mr1350 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643 NA 4.50E-32 mr1423 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643 NA 3.44E-37 mr1435 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643 NA 4.24E-20 mr1477 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643 NA 6.43E-53 mr1599 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643 NA 6.33E-12 mr1636 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643 NA 3.99E-13 mr1641 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643 NA 4.64E-08 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643 NA 3.50E-10 mr1714 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643 NA 9.52E-14 mr1909 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643 NA 3.71E-10 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643 NA 8.43E-32 mr1085_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643 3.09E-06 5.22E-56 mr1089_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643 9.29E-08 2.26E-60 mr1093_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643 NA 5.07E-37 mr1104_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643 NA 8.30E-36 mr1107_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643 NA 1.18E-11 mr1138_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643 NA 3.78E-54 mr1141_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643 NA 1.91E-41 mr1145_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643 NA 3.04E-36 mr1155_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643 NA 5.29E-21 mr1175_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643 NA 3.66E-75 mr1178_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643 NA 1.74E-61 mr1235_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643 NA 7.68E-47 mr1243_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643 NA 1.66E-12 mr1248_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643 NA 1.09E-42 mr1251_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643 NA 2.51E-39 mr1257_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643 NA 3.82E-09 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643 NA 8.41E-24 mr1403_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643 NA 5.59E-33 mr1423_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643 NA 1.76E-42 mr1435_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643 NA 4.42E-71 mr1599_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643 NA 1.30E-18 mr1637_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643 NA 4.34E-35 mr1780_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251