Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0217956643:

Variant ID: vg0217956643 (JBrowse)	Variation Type: INDEL
Chromosome: chr02	Position: 17956643
Reference Allele: AAAAGTCTTATAATCTAAAAGTAGGTAG	Alternative Allele: A,GAAAGTCTTATAATCTAAAAGTAGGTAG
Primary Allele: A	Secondary Allele: AAAAGTCTTATAATCTAAAA GTAGGTAG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AACTAGCATAATCAAACAAACTACTTCATTCGTTTCATATTATAAGACTTTCTAGCATTATCCACATTCATTAGTATCTATATAAATATAGATAATGCTA[AAAAGTCTTATAATCTAAAAGTAGGTAG/A,GAAAGTCTTATAATCTAAAAGTAGGTAG]
AACAAGCGAACAGTATTTTATTTTATCTAGGAAAGGCGCATAAGAAGAAGTGAAGAACTTTTTTGGTTATATAATGCAATTGACCAGTATTATTACTAGT

Reverse complement sequence

ACTAGTAATAATACTGGTCAATTGCATTATATAACCAAAAAAGTTCTTCACTTCTTCTTATGCGCCTTTCCTAGATAAAATAAAATACTGTTCGCTTGTT[CTACCTACTTTTAGATTATAAGACTTTT/T,CTACCTACTTTTAGATTATAAGACTTTC]
TAGCATTATCTATATTTATATAGATACTAATGAATGTGGATAATGCTAGAAAGTCTTATAATATGAAACGAATGAAGTAGTTTGTTTGATTATGCTAGTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of AAAAGTCTTATAATCTAAAA GTAGGTAG(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	17.80%	17.50%	0.85%	62.42%	GAAAGTCTTATAATCTAAAAGTAGGTAG: 1.50%
All Indica	2759	5.80%	0.50%	0.69%	90.97%	GAAAGTCTTATAATCTAAAAGTAGGTAG: 2.07%
All Japonica	1512	43.40%	52.40%	0.46%	3.51%	GAAAGTCTTATAATCTAAAAGTAGGTAG: 0.20%
Aus	269	0.00%	0.70%	4.83%	91.45%	GAAAGTCTTATAATCTAAAAGTAGGTAG: 2.97%
Indica I	595	0.00%	0.30%	1.01%	95.29%	GAAAGTCTTATAATCTAAAAGTAGGTAG: 3.36%
Indica II	465	10.50%	0.60%	0.43%	85.16%	GAAAGTCTTATAATCTAAAAGTAGGTAG: 3.23%
Indica III	913	9.00%	0.20%	0.55%	90.25%	NA
Indica Intermediate	786	3.70%	0.80%	0.76%	91.98%	GAAAGTCTTATAATCTAAAAGTAGGTAG: 2.80%
Temperate Japonica	767	5.30%	93.20%	0.00%	1.43%	NA
Tropical Japonica	504	89.30%	4.00%	0.99%	5.16%	GAAAGTCTTATAATCTAAAAGTAGGTAG: 0.60%
Japonica Intermediate	241	68.50%	24.10%	0.83%	6.64%	NA
VI/Aromatic	96	4.20%	4.20%	0.00%	90.62%	GAAAGTCTTATAATCTAAAAGTAGGTAG: 1.04%
Intermediate	90	21.10%	15.60%	1.11%	60.00%	GAAAGTCTTATAATCTAAAAGTAGGTAG: 2.22%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0217956643	AAAAGTCTTATAATCTAAAAGTAGGTAG -> A	LOC_Os02g30210.1	downstream_gene_variant ; 1852.0bp to feature; MODIFIER	silent_mutation	Average:59.603; most accessible tissue: Zhenshan97 flower, score: 69.089	N	N	N	N
vg0217956643	AAAAGTCTTATAATCTAAAAGTAGGTAG -> A	LOC_Os02g30210.2	downstream_gene_variant ; 1852.0bp to feature; MODIFIER	silent_mutation	Average:59.603; most accessible tissue: Zhenshan97 flower, score: 69.089	N	N	N	N
vg0217956643	AAAAGTCTTATAATCTAAAAGTAGGTAG -> A	LOC_Os02g30200.1	intron_variant ; MODIFIER	silent_mutation	Average:59.603; most accessible tissue: Zhenshan97 flower, score: 69.089	N	N	N	N
vg0217956643	AAAAGTCTTATAATCTAAAAGTAGGTAG -> GAAAGTCTTATAATCTAAAAGTAGGTAG	LOC_Os02g30210.1	downstream_gene_variant ; 1853.0bp to feature; MODIFIER	silent_mutation	Average:59.603; most accessible tissue: Zhenshan97 flower, score: 69.089	N	N	N	N
vg0217956643	AAAAGTCTTATAATCTAAAAGTAGGTAG -> GAAAGTCTTATAATCTAAAAGTAGGTAG	LOC_Os02g30210.2	downstream_gene_variant ; 1853.0bp to feature; MODIFIER	silent_mutation	Average:59.603; most accessible tissue: Zhenshan97 flower, score: 69.089	N	N	N	N
vg0217956643	AAAAGTCTTATAATCTAAAAGTAGGTAG -> GAAAGTCTTATAATCTAAAAGTAGGTAG	LOC_Os02g30200.1	intron_variant ; MODIFIER	silent_mutation	Average:59.603; most accessible tissue: Zhenshan97 flower, score: 69.089	N	N	N	N
vg0217956643	AAAAGTCTTATAATCTAAAAGTAGGTAG -> DEL	N	N	silent_mutation	Average:59.603; most accessible tissue: Zhenshan97 flower, score: 69.089	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0217956643	2.00E-06	NA	mr1036	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643	2.86E-06	1.85E-43	mr1089	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643	3.32E-06	9.92E-47	mr1093	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643	NA	2.96E-09	mr1198	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643	NA	3.68E-26	mr1223	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643	NA	1.13E-40	mr1235	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643	NA	6.66E-34	mr1243	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643	NA	4.48E-17	mr1253	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643	NA	4.58E-15	mr1276	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643	NA	1.64E-12	mr1326	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643	NA	3.80E-35	mr1350	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643	NA	4.50E-32	mr1423	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643	NA	3.44E-37	mr1435	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643	NA	4.24E-20	mr1477	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643	NA	6.43E-53	mr1599	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643	NA	6.33E-12	mr1636	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643	NA	3.99E-13	mr1641	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643	NA	4.64E-08	mr1690	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643	NA	3.50E-10	mr1714	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643	NA	9.52E-14	mr1909	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643	NA	3.71E-10	mr1921	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643	NA	8.43E-32	mr1085_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643	3.09E-06	5.22E-56	mr1089_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643	9.29E-08	2.26E-60	mr1093_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643	NA	5.07E-37	mr1104_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643	NA	8.30E-36	mr1107_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643	NA	1.18E-11	mr1138_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643	NA	3.78E-54	mr1141_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643	NA	1.91E-41	mr1145_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643	NA	3.04E-36	mr1155_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643	NA	5.29E-21	mr1175_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643	NA	3.66E-75	mr1178_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643	NA	1.74E-61	mr1235_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643	NA	7.68E-47	mr1243_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643	NA	1.66E-12	mr1248_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643	NA	1.09E-42	mr1251_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643	NA	2.51E-39	mr1257_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643	NA	3.82E-09	mr1379_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643	NA	8.41E-24	mr1403_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643	NA	5.59E-33	mr1423_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643	NA	1.76E-42	mr1435_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643	NA	4.42E-71	mr1599_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643	NA	1.30E-18	mr1637_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217956643	NA	4.34E-35	mr1780_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251