\
| Variant ID: vg0217953192 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 17953192 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.03, others allele: 0.00, population size: 117. )
AAGAAAAAAAAAAGACCCTTTCTCAACTAACAAAACAAATGAGCTACAAGAGTACTAACTACGGTTCTATAATAATTGATGCTTTGGACAAGGTTGAGGT[C/T]
AAACTTTTATAACTTTGACCATAAATAACTTTAAAAATATTTGGTTTAAAGAAACTAAAACAACATTTATAGATTTATCTTTCAAAGCACTATAATAAAA
TTTTATTATAGTGCTTTGAAAGATAAATCTATAAATGTTGTTTTAGTTTCTTTAAACCAAATATTTTTAAAGTTATTTATGGTCAAAGTTATAAAAGTTT[G/A]
ACCTCAACCTTGTCCAAAGCATCAATTATTATAGAACCGTAGTTAGTACTCTTGTAGCTCATTTGTTTTGTTAGTTGAGAAAGGGTCTTTTTTTTTTCTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.10% | 36.50% | 0.38% | 0.06% | NA |
| All Indica | 2759 | 45.70% | 53.70% | 0.51% | 0.07% | NA |
| All Japonica | 1512 | 97.20% | 2.80% | 0.00% | 0.00% | NA |
| Aus | 269 | 36.40% | 63.20% | 0.37% | 0.00% | NA |
| Indica I | 595 | 19.50% | 80.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 25.20% | 74.00% | 0.86% | 0.00% | NA |
| Indica III | 913 | 79.70% | 19.90% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 38.20% | 60.70% | 0.89% | 0.25% | NA |
| Temperate Japonica | 767 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 95.00% | 5.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 64.40% | 31.10% | 3.33% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0217953192 | C -> T | LOC_Os02g30190.1 | downstream_gene_variant ; 2251.0bp to feature; MODIFIER | silent_mutation | Average:29.025; most accessible tissue: Callus, score: 56.286 | N | N | N | N |
| vg0217953192 | C -> T | LOC_Os02g30200.1 | intron_variant ; MODIFIER | silent_mutation | Average:29.025; most accessible tissue: Callus, score: 56.286 | N | N | N | N |
| vg0217953192 | C -> DEL | N | N | silent_mutation | Average:29.025; most accessible tissue: Callus, score: 56.286 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0217953192 | NA | 6.40E-08 | mr1138 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217953192 | NA | 2.37E-07 | mr1169 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217953192 | NA | 6.94E-06 | mr1317 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217953192 | NA | 1.21E-06 | mr1646 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217953192 | 9.70E-07 | NA | mr1855 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217953192 | NA | 6.03E-12 | mr1138_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217953192 | NA | 2.06E-06 | mr1138_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217953192 | 9.56E-06 | NA | mr1169_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217953192 | 2.36E-06 | 3.19E-07 | mr1169_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217953192 | NA | 4.73E-07 | mr1317_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217953192 | NA | 3.01E-07 | mr1559_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217953192 | NA | 3.46E-10 | mr1806_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217953192 | NA | 1.28E-08 | mr1806_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217953192 | NA | 4.26E-07 | mr1807_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217953192 | NA | 9.20E-07 | mr1818_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217953192 | 1.53E-08 | NA | mr1855_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217953192 | NA | 1.76E-06 | mr1870_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |