\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0217951693:

Variant ID: vg0217951693 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 17951693
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, T: 0.01, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


CTGCACTGGACCTGCCCTTTTGTTCTTCTTGGTGACATATAAAGGCACATTTGAATATTTGAAGAGATTCATATAATGGAAATACTTTGCCTTTGCTTGA[A/T]
TATAGGTGCATAGAAAATATAGAATGCGATACAGGTCTGTAACATATATATATCTAAGTATATAAATCAGCTTCTACAGTTTCCCTTTCCTATCTTGGCT

Reverse complement sequence

AGCCAAGATAGGAAAGGGAAACTGTAGAAGCTGATTTATATACTTAGATATATATATGTTACAGACCTGTATCGCATTCTATATTTTCTATGCACCTATA[T/A]
TCAAGCAAAGGCAAAGTATTTCCATTATATGAATCTCTTCAAATATTCAAATGTGCCTTTATATGTCACCAAGAAGAACAAAAGGGCAGGTCCAGTGCAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.00% 24.50% 0.30% 0.17% NA
All Indica  2759 60.90% 38.50% 0.36% 0.22% NA
All Japonica  1512 99.50% 0.40% 0.07% 0.00% NA
Aus  269 69.50% 30.10% 0.00% 0.37% NA
Indica I  595 81.20% 18.50% 0.34% 0.00% NA
Indica II  465 86.20% 13.50% 0.00% 0.22% NA
Indica III  913 29.60% 69.80% 0.33% 0.33% NA
Indica Intermediate  786 67.00% 32.10% 0.64% 0.25% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.20% 0.60% 0.20% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 84.40% 12.20% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0217951693 A -> T LOC_Os02g30190.1 downstream_gene_variant ; 752.0bp to feature; MODIFIER silent_mutation Average:52.737; most accessible tissue: Minghui63 young leaf, score: 76.385 N N N N
vg0217951693 A -> T LOC_Os02g30200.1 downstream_gene_variant ; 536.0bp to feature; MODIFIER silent_mutation Average:52.737; most accessible tissue: Minghui63 young leaf, score: 76.385 N N N N
vg0217951693 A -> T LOC_Os02g30190-LOC_Os02g30200 intergenic_region ; MODIFIER silent_mutation Average:52.737; most accessible tissue: Minghui63 young leaf, score: 76.385 N N N N
vg0217951693 A -> DEL N N silent_mutation Average:52.737; most accessible tissue: Minghui63 young leaf, score: 76.385 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0217951693 6.12E-07 NA mr1855 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217951693 NA 4.93E-07 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217951693 NA 5.36E-07 mr1169_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217951693 NA 2.99E-06 mr1277_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217951693 NA 3.38E-06 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217951693 NA 7.87E-06 mr1428_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217951693 NA 1.53E-08 mr1510_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217951693 NA 9.77E-08 mr1510_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217951693 NA 8.79E-06 mr1702_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217951693 NA 3.94E-06 mr1702_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217951693 NA 6.53E-06 mr1740_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217951693 NA 7.87E-06 mr1741_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217951693 NA 3.43E-06 mr1788_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217951693 NA 1.51E-09 mr1806_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217951693 NA 7.23E-06 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217951693 1.66E-07 NA mr1855_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217951693 NA 9.86E-08 mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217951693 8.95E-06 NA mr1914_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251