\
| Variant ID: vg0217951693 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 17951693 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, T: 0.01, others allele: 0.00, population size: 236. )
CTGCACTGGACCTGCCCTTTTGTTCTTCTTGGTGACATATAAAGGCACATTTGAATATTTGAAGAGATTCATATAATGGAAATACTTTGCCTTTGCTTGA[A/T]
TATAGGTGCATAGAAAATATAGAATGCGATACAGGTCTGTAACATATATATATCTAAGTATATAAATCAGCTTCTACAGTTTCCCTTTCCTATCTTGGCT
AGCCAAGATAGGAAAGGGAAACTGTAGAAGCTGATTTATATACTTAGATATATATATGTTACAGACCTGTATCGCATTCTATATTTTCTATGCACCTATA[T/A]
TCAAGCAAAGGCAAAGTATTTCCATTATATGAATCTCTTCAAATATTCAAATGTGCCTTTATATGTCACCAAGAAGAACAAAAGGGCAGGTCCAGTGCAG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.00% | 24.50% | 0.30% | 0.17% | NA |
| All Indica | 2759 | 60.90% | 38.50% | 0.36% | 0.22% | NA |
| All Japonica | 1512 | 99.50% | 0.40% | 0.07% | 0.00% | NA |
| Aus | 269 | 69.50% | 30.10% | 0.00% | 0.37% | NA |
| Indica I | 595 | 81.20% | 18.50% | 0.34% | 0.00% | NA |
| Indica II | 465 | 86.20% | 13.50% | 0.00% | 0.22% | NA |
| Indica III | 913 | 29.60% | 69.80% | 0.33% | 0.33% | NA |
| Indica Intermediate | 786 | 67.00% | 32.10% | 0.64% | 0.25% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.20% | 0.60% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 84.40% | 12.20% | 2.22% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0217951693 | A -> T | LOC_Os02g30190.1 | downstream_gene_variant ; 752.0bp to feature; MODIFIER | silent_mutation | Average:52.737; most accessible tissue: Minghui63 young leaf, score: 76.385 | N | N | N | N |
| vg0217951693 | A -> T | LOC_Os02g30200.1 | downstream_gene_variant ; 536.0bp to feature; MODIFIER | silent_mutation | Average:52.737; most accessible tissue: Minghui63 young leaf, score: 76.385 | N | N | N | N |
| vg0217951693 | A -> T | LOC_Os02g30190-LOC_Os02g30200 | intergenic_region ; MODIFIER | silent_mutation | Average:52.737; most accessible tissue: Minghui63 young leaf, score: 76.385 | N | N | N | N |
| vg0217951693 | A -> DEL | N | N | silent_mutation | Average:52.737; most accessible tissue: Minghui63 young leaf, score: 76.385 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0217951693 | 6.12E-07 | NA | mr1855 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217951693 | NA | 4.93E-07 | mr1063_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217951693 | NA | 5.36E-07 | mr1169_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217951693 | NA | 2.99E-06 | mr1277_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217951693 | NA | 3.38E-06 | mr1317_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217951693 | NA | 7.87E-06 | mr1428_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217951693 | NA | 1.53E-08 | mr1510_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217951693 | NA | 9.77E-08 | mr1510_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217951693 | NA | 8.79E-06 | mr1702_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217951693 | NA | 3.94E-06 | mr1702_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217951693 | NA | 6.53E-06 | mr1740_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217951693 | NA | 7.87E-06 | mr1741_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217951693 | NA | 3.43E-06 | mr1788_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217951693 | NA | 1.51E-09 | mr1806_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217951693 | NA | 7.23E-06 | mr1818_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217951693 | 1.66E-07 | NA | mr1855_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217951693 | NA | 9.86E-08 | mr1870_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217951693 | 8.95E-06 | NA | mr1914_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |