\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0217924433:

Variant ID: vg0217924433 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 17924433
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:


GGCCCTGTATGGTCGGTCTGACCAGTTCTGGGCAGAGCGCTGGGGGGCACGTTTCAATCAATTTAGAGGCCGAATTAATTGTGAATTCGGACATTTGTGC[C/T]
TAGGAAGCAGAAGAAGATTGGAGAATTCCTTTGATTCGATATTTGAAAGATCCCACGCTTAAGGTTGATCGGAAAATTCGGCGACAAGCGTTCAAATACA

Reverse complement sequence

TGTATTTGAACGCTTGTCGCCGAATTTTCCGATCAACCTTAAGCGTGGGATCTTTCAAATATCGAATCAAAGGAATTCTCCAATCTTCTTCTGCTTCCTA[G/A]
GCACAAATGTCCGAATTCACAATTAATTCGGCCTCTAAATTGATTGAAACGTGCCCCCCAGCGCTCTGCCCAGAACTGGTCAGACCGACCATACAGGGCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.30% 6.00% 3.20% 4.55% NA
All Indica  2759 82.60% 6.70% 4.20% 6.49% NA
All Japonica  1512 99.50% 0.30% 0.13% 0.00% NA
Aus  269 44.60% 30.50% 11.90% 13.01% NA
Indica I  595 75.10% 8.20% 4.71% 11.93% NA
Indica II  465 74.80% 12.70% 6.88% 5.59% NA
Indica III  913 90.80% 3.30% 2.74% 3.18% NA
Indica Intermediate  786 83.30% 6.00% 3.94% 6.74% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.00% 0.80% 0.20% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 87.80% 10.00% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0217924433 C -> T LOC_Os02g30160.1 splice_region_variant&intron_variant ; LOW silent_mutation Average:59.471; most accessible tissue: Minghui63 flag leaf, score: 87.461 N N N N
vg0217924433 C -> T LOC_Os02g30170.1 upstream_gene_variant ; 3716.0bp to feature; MODIFIER silent_mutation Average:59.471; most accessible tissue: Minghui63 flag leaf, score: 87.461 N N N N
vg0217924433 C -> DEL N N silent_mutation Average:59.471; most accessible tissue: Minghui63 flag leaf, score: 87.461 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0217924433 NA 6.63E-07 mr1129 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217924433 NA 3.47E-06 mr1148 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217924433 NA 3.56E-11 mr1317 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217924433 1.10E-06 1.86E-12 mr1317 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217924433 NA 2.48E-06 mr1818 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217924433 2.44E-09 7.01E-35 mr1855 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217924433 2.89E-09 1.38E-24 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217924433 4.10E-06 6.47E-07 mr1931 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217924433 NA 5.29E-08 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217924433 NA 5.14E-06 mr1253_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217924433 NA 1.41E-06 mr1255_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217924433 1.61E-06 4.12E-16 mr1317_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217924433 2.40E-06 2.37E-15 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217924433 NA 8.92E-09 mr1608_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217924433 NA 8.95E-08 mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217924433 NA 1.43E-08 mr1610_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217924433 3.04E-06 7.28E-16 mr1818_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217924433 NA 1.23E-11 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217924433 4.38E-06 1.51E-33 mr1855_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217924433 6.35E-06 2.13E-22 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217924433 2.59E-07 8.99E-18 mr1897_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217924433 9.49E-07 1.08E-13 mr1897_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217924433 NA 8.55E-15 mr1914_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217924433 NA 6.43E-13 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217924433 1.27E-06 4.20E-18 mr1927_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217924433 NA 1.31E-14 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251