\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0217919982:

Variant ID: vg0217919982 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 17919982
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.07, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:


GAGCATATTGTAAATGGCATGATTCTCATTCTCATTCTACTAATGATTGCAATGTGTTTCGACGACAGGTTCAATCGGCCATAGATGAAGGACGATTGAA[G/A]
TTCACCGATGGCTCTAAGATGAAGCTTGATCATGATCCTTTTCCAGTGAATACGATTAATTTCAATGATAAGAAGGTGTTGATCCGGCCGGAGCAAGCCG

Reverse complement sequence

CGGCTTGCTCCGGCCGGATCAACACCTTCTTATCATTGAAATTAATCGTATTCACTGGAAAAGGATCATGATCAAGCTTCATCTTAGAGCCATCGGTGAA[C/T]
TTCAATCGTCCTTCATCTATGGCCGATTGAACCTGTCGTCGAAACACATTGCAATCATTAGTAGAATGAGAATGAGAATCATGCCATTTACAATATGCTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.80% 34.10% 0.06% 0.00% NA
All Indica  2759 80.00% 19.90% 0.07% 0.00% NA
All Japonica  1512 48.10% 51.90% 0.00% 0.00% NA
Aus  269 41.60% 58.40% 0.00% 0.00% NA
Indica I  595 71.10% 28.70% 0.17% 0.00% NA
Indica II  465 72.50% 27.50% 0.00% 0.00% NA
Indica III  913 88.80% 11.20% 0.00% 0.00% NA
Indica Intermediate  786 81.00% 18.80% 0.13% 0.00% NA
Temperate Japonica  767 6.60% 93.40% 0.00% 0.00% NA
Tropical Japonica  504 97.40% 2.60% 0.00% 0.00% NA
Japonica Intermediate  241 76.80% 23.20% 0.00% 0.00% NA
VI/Aromatic  96 9.40% 90.60% 0.00% 0.00% NA
Intermediate  90 60.00% 38.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0217919982 G -> A LOC_Os02g30160.1 synonymous_variant ; p.Lys561Lys; LOW synonymous_codon Average:35.68; most accessible tissue: Minghui63 flag leaf, score: 47.544 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0217919982 NA 1.01E-07 mr1129 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217919982 2.64E-08 3.11E-15 mr1317 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217919982 1.21E-08 2.13E-16 mr1317 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217919982 NA 5.12E-06 mr1571 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217919982 NA 3.86E-06 mr1585 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217919982 NA 2.59E-07 mr1608 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217919982 1.77E-06 2.41E-07 mr1610 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217919982 NA 6.63E-06 mr1818 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217919982 1.02E-08 NA mr1855 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217919982 2.32E-09 6.42E-27 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217919982 NA 1.39E-07 mr1897 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217919982 8.20E-06 6.37E-08 mr1927 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217919982 NA 3.00E-09 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217919982 NA 5.90E-08 mr1156_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217919982 NA 7.75E-07 mr1255_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217919982 NA 5.72E-09 mr1257_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217919982 1.35E-06 5.84E-15 mr1317_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217919982 NA 6.27E-17 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217919982 NA 2.97E-08 mr1585_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217919982 NA 1.30E-09 mr1608_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217919982 NA 2.63E-10 mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217919982 NA 1.87E-08 mr1610_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217919982 4.61E-06 NA mr1818_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217919982 NA 5.39E-13 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217919982 1.55E-09 NA mr1855_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217919982 4.98E-09 3.75E-30 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217919982 NA 3.00E-09 mr1864_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217919982 NA 4.66E-13 mr1897_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217919982 NA 1.33E-19 mr1914_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217919982 NA 9.90E-17 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217919982 3.61E-07 3.38E-19 mr1927_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217919982 NA 8.10E-19 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251