Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0217855786:

Variant ID: vg0217855786 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 17855786
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 66. )

Flanking Sequence (100 bp) in Reference Genome:

ATCCAAATCACATGAGAAAACCGACAGACTCTAGGTGGGAGTAGGTTTCGGGTTGTATTCGTGGGATTTCTAGATTGCTTTATGGATATAACTTCTAGAT[G/A]
GTTTCTTTTCATATGCGATGCTCGGTCAGACCACAGGTGAACCGGTGGTCAGACCGGTAGCCAAGCCCGGTCAGACTGCAGGTACAACGGCGATCAGACT

Reverse complement sequence

AGTCTGATCGCCGTTGTACCTGCAGTCTGACCGGGCTTGGCTACCGGTCTGACCACCGGTTCACCTGTGGTCTGACCGAGCATCGCATATGAAAAGAAAC[C/T]
ATCTAGAAGTTATATCCATAAAGCAATCTAGAAATCCCACGAATACAACCCGAAACCTACTCCCACCTAGAGTCTGTCGGTTTTCTCATGTGATTTGGAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	17.40%	14.80%	0.34%	67.46%	NA
All Indica	2759	0.90%	19.00%	0.40%	79.74%	NA
All Japonica	1512	51.20%	0.70%	0.00%	48.08%	NA
Aus	269	0.40%	55.00%	0.74%	43.87%	NA
Indica I	595	1.70%	24.90%	0.50%	72.94%	NA
Indica II	465	0.60%	28.60%	0.43%	70.32%	NA
Indica III	913	0.50%	10.80%	0.00%	88.61%	NA
Indica Intermediate	786	0.80%	18.30%	0.76%	80.15%	NA
Temperate Japonica	767	93.40%	0.10%	0.00%	6.52%	NA
Tropical Japonica	504	1.20%	1.60%	0.00%	97.22%	NA
Japonica Intermediate	241	21.60%	0.80%	0.00%	77.59%	NA
VI/Aromatic	96	7.30%	4.20%	0.00%	88.54%	NA
Intermediate	90	16.70%	15.60%	3.33%	64.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0217855786	G -> A	LOC_Os02g30060.1	upstream_gene_variant ; 3227.0bp to feature; MODIFIER	silent_mutation	Average:11.489; most accessible tissue: Callus, score: 66.462	N	N	N	N
vg0217855786	G -> A	LOC_Os02g30070.1	upstream_gene_variant ; 3863.0bp to feature; MODIFIER	silent_mutation	Average:11.489; most accessible tissue: Callus, score: 66.462	N	N	N	N
vg0217855786	G -> A	LOC_Os02g30060-LOC_Os02g30070	intergenic_region ; MODIFIER	silent_mutation	Average:11.489; most accessible tissue: Callus, score: 66.462	N	N	N	N
vg0217855786	G -> DEL	N	N	silent_mutation	Average:11.489; most accessible tissue: Callus, score: 66.462	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0217855786	NA	5.71E-07	mr1317	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217855786	NA	1.59E-08	mr1855	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217855786	NA	4.92E-06	mr1253_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217855786	NA	2.57E-09	mr1317_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217855786	NA	2.80E-06	mr1324_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217855786	1.77E-07	1.77E-07	mr1325_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217855786	3.55E-06	3.55E-06	mr1326_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217855786	NA	7.96E-07	mr1557_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217855786	7.67E-06	7.67E-06	mr1562_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217855786	NA	2.94E-06	mr1608_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217855786	NA	2.69E-06	mr1610_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217855786	NA	3.53E-06	mr1623_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217855786	NA	1.36E-11	mr1818_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217855786	NA	1.93E-07	mr1818_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217855786	NA	4.82E-08	mr1855_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217855786	7.66E-06	4.34E-13	mr1897_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217855786	NA	6.20E-07	mr1897_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217855786	NA	1.00E-06	mr1914_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217855786	NA	3.96E-06	mr1927_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217855786	NA	4.86E-06	mr1944_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251