\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0217855786:

Variant ID: vg0217855786 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 17855786
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 66. )

Flanking Sequence (100 bp) in Reference Genome:


ATCCAAATCACATGAGAAAACCGACAGACTCTAGGTGGGAGTAGGTTTCGGGTTGTATTCGTGGGATTTCTAGATTGCTTTATGGATATAACTTCTAGAT[G/A]
GTTTCTTTTCATATGCGATGCTCGGTCAGACCACAGGTGAACCGGTGGTCAGACCGGTAGCCAAGCCCGGTCAGACTGCAGGTACAACGGCGATCAGACT

Reverse complement sequence

AGTCTGATCGCCGTTGTACCTGCAGTCTGACCGGGCTTGGCTACCGGTCTGACCACCGGTTCACCTGTGGTCTGACCGAGCATCGCATATGAAAAGAAAC[C/T]
ATCTAGAAGTTATATCCATAAAGCAATCTAGAAATCCCACGAATACAACCCGAAACCTACTCCCACCTAGAGTCTGTCGGTTTTCTCATGTGATTTGGAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 17.40% 14.80% 0.34% 67.46% NA
All Indica  2759 0.90% 19.00% 0.40% 79.74% NA
All Japonica  1512 51.20% 0.70% 0.00% 48.08% NA
Aus  269 0.40% 55.00% 0.74% 43.87% NA
Indica I  595 1.70% 24.90% 0.50% 72.94% NA
Indica II  465 0.60% 28.60% 0.43% 70.32% NA
Indica III  913 0.50% 10.80% 0.00% 88.61% NA
Indica Intermediate  786 0.80% 18.30% 0.76% 80.15% NA
Temperate Japonica  767 93.40% 0.10% 0.00% 6.52% NA
Tropical Japonica  504 1.20% 1.60% 0.00% 97.22% NA
Japonica Intermediate  241 21.60% 0.80% 0.00% 77.59% NA
VI/Aromatic  96 7.30% 4.20% 0.00% 88.54% NA
Intermediate  90 16.70% 15.60% 3.33% 64.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0217855786 G -> A LOC_Os02g30060.1 upstream_gene_variant ; 3227.0bp to feature; MODIFIER silent_mutation Average:11.489; most accessible tissue: Callus, score: 66.462 N N N N
vg0217855786 G -> A LOC_Os02g30070.1 upstream_gene_variant ; 3863.0bp to feature; MODIFIER silent_mutation Average:11.489; most accessible tissue: Callus, score: 66.462 N N N N
vg0217855786 G -> A LOC_Os02g30060-LOC_Os02g30070 intergenic_region ; MODIFIER silent_mutation Average:11.489; most accessible tissue: Callus, score: 66.462 N N N N
vg0217855786 G -> DEL N N silent_mutation Average:11.489; most accessible tissue: Callus, score: 66.462 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0217855786 NA 5.71E-07 mr1317 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217855786 NA 1.59E-08 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217855786 NA 4.92E-06 mr1253_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217855786 NA 2.57E-09 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217855786 NA 2.80E-06 mr1324_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217855786 1.77E-07 1.77E-07 mr1325_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217855786 3.55E-06 3.55E-06 mr1326_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217855786 NA 7.96E-07 mr1557_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217855786 7.67E-06 7.67E-06 mr1562_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217855786 NA 2.94E-06 mr1608_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217855786 NA 2.69E-06 mr1610_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217855786 NA 3.53E-06 mr1623_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217855786 NA 1.36E-11 mr1818_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217855786 NA 1.93E-07 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217855786 NA 4.82E-08 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217855786 7.66E-06 4.34E-13 mr1897_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217855786 NA 6.20E-07 mr1897_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217855786 NA 1.00E-06 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217855786 NA 3.96E-06 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217855786 NA 4.86E-06 mr1944_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251