\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0217845387:

Variant ID: vg0217845387 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 17845387
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.83, A: 0.17, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


GAAGTCGAGGCTGCCGAACCGGAACGCCTGCCTAGGAGGGAAGACGAAGTCGTCGATGTCGGAAACGAAACCCATCGCATTAGTCGGCGAAGTACTTGAC[A/G]
CTACCCCTACTTGGCGCGCCAACTGTCAAAACAAGATTTCGACAATACTAAAGGGGGTGGCTATCAAACTGGAAAAGTGGATGGTTTAAGAGACAAGGAA

Reverse complement sequence

TTCCTTGTCTCTTAAACCATCCACTTTTCCAGTTTGATAGCCACCCCCTTTAGTATTGTCGAAATCTTGTTTTGACAGTTGGCGCGCCAAGTAGGGGTAG[T/C]
GTCAAGTACTTCGCCGACTAATGCGATGGGTTTCGTTTCCGACATCGACGACTTCGTCTTCCCTCCTAGGCAGGCGTTCCGGTTCGGCAGCCTCGACTTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.30% 20.30% 7.32% 0.02% NA
All Indica  2759 82.90% 5.40% 11.63% 0.04% NA
All Japonica  1512 48.70% 51.10% 0.20% 0.00% NA
Aus  269 87.40% 5.60% 7.06% 0.00% NA
Indica I  595 76.60% 4.20% 19.16% 0.00% NA
Indica II  465 94.00% 2.40% 3.66% 0.00% NA
Indica III  913 80.70% 7.30% 11.94% 0.00% NA
Indica Intermediate  786 83.60% 6.00% 10.31% 0.13% NA
Temperate Japonica  767 6.60% 93.40% 0.00% 0.00% NA
Tropical Japonica  504 98.60% 1.00% 0.40% 0.00% NA
Japonica Intermediate  241 78.40% 21.20% 0.41% 0.00% NA
VI/Aromatic  96 90.60% 9.40% 0.00% 0.00% NA
Intermediate  90 81.10% 15.60% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0217845387 A -> G LOC_Os02g30030.1 upstream_gene_variant ; 3718.0bp to feature; MODIFIER silent_mutation Average:69.657; most accessible tissue: Minghui63 young leaf, score: 87.217 N N N N
vg0217845387 A -> G LOC_Os02g30040.1 upstream_gene_variant ; 26.0bp to feature; MODIFIER silent_mutation Average:69.657; most accessible tissue: Minghui63 young leaf, score: 87.217 N N N N
vg0217845387 A -> G LOC_Os02g30050.1 upstream_gene_variant ; 898.0bp to feature; MODIFIER silent_mutation Average:69.657; most accessible tissue: Minghui63 young leaf, score: 87.217 N N N N
vg0217845387 A -> G LOC_Os02g30060.1 downstream_gene_variant ; 2795.0bp to feature; MODIFIER silent_mutation Average:69.657; most accessible tissue: Minghui63 young leaf, score: 87.217 N N N N
vg0217845387 A -> G LOC_Os02g30040-LOC_Os02g30050 intergenic_region ; MODIFIER silent_mutation Average:69.657; most accessible tissue: Minghui63 young leaf, score: 87.217 N N N N
vg0217845387 A -> DEL N N silent_mutation Average:69.657; most accessible tissue: Minghui63 young leaf, score: 87.217 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0217845387 A G -0.01 -0.01 -0.01 -0.01 -0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0217845387 3.95E-06 3.95E-06 mr1248 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217845387 NA 1.37E-10 mr1368 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217845387 NA 2.86E-06 mr1368 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217845387 NA 1.11E-09 mr1563 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217845387 NA 7.60E-08 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217845387 NA 5.56E-08 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217845387 NA 4.66E-08 mr1156_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217845387 NA 7.06E-08 mr1350_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217845387 NA 9.13E-11 mr1368_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217845387 NA 1.87E-07 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217845387 NA 1.65E-09 mr1864_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251