\
| Variant ID: vg0217843760 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 17843760 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.03, others allele: 0.00, population size: 85. )
TGCCGACTAGGTCATCGTGGCGAATGCCCTTGGTGAAGGCAGCGATGATGACGTCGTCGGTGATGTCGGAGATCTTGTTGCGTTGCTCGGAAAAGCGTCT[G/A]
ATGTAATCTCGAAGGGATTCTCTAGACTTCTGAACAACATTGTAGAGATCAAACTGTGTACTAGGGCGTTCAAAGATACCCTGGAAGTTGGCGATGAAGT
ACTTCATCGCCAACTTCCAGGGTATCTTTGAACGCCCTAGTACACAGTTTGATCTCTACAATGTTGTTCAGAAGTCTAGAGAATCCCTTCGAGATTACAT[C/T]
AGACGCTTTTCCGAGCAACGCAACAAGATCTCCGACATCACCGACGACGTCATCATCGCTGCCTTCACCAAGGGCATTCGCCACGATGACCTAGTCGGCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 73.00% | 27.00% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 59.30% | 40.60% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 79.60% | 20.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 69.90% | 30.10% | 0.00% | 0.00% | NA |
| Indica II | 465 | 86.70% | 13.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 33.70% | 66.20% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 64.90% | 35.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 20.80% | 79.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 17.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0217843760 | G -> A | LOC_Os02g30040.1 | synonymous_variant ; p.Ile474Ile; LOW | synonymous_codon | Average:53.328; most accessible tissue: Zhenshan97 flag leaf, score: 73.822 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0217843760 | 7.24E-07 | 5.12E-12 | mr1317 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217843760 | NA | 5.29E-06 | mr1317 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217843760 | 3.64E-06 | 3.02E-08 | mr1610 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217843760 | 1.68E-07 | NA | mr1855 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217843760 | 3.84E-06 | 5.65E-11 | mr1317_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217843760 | 1.89E-06 | 2.44E-06 | mr1608_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217843760 | 3.93E-06 | NA | mr1610_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217843760 | 3.43E-06 | NA | mr1818_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217843760 | 2.22E-08 | NA | mr1855_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217843760 | 9.29E-06 | NA | mr1897_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217843760 | 3.06E-07 | NA | mr1914_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217843760 | NA | 3.99E-06 | mr1914_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217843760 | 6.76E-07 | NA | mr1927_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217843760 | NA | 5.01E-06 | mr1927_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |