Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0217842911:

Variant ID: vg0217842911 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 17842911
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.01, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


TGTTCTCTGTGCGGAAGTTCTCCCGAGTGCCGAAAGTAACCGGAAGAATGATCTGGCCGAGTGGTGTAGTAGATAGCCCTGGGATGACTCCGTGAAAGGG[C/T]
ACATTACTCGGCTTTAATTCCGTGCGAGGGATCTGCATGTCGTCCAGAGTCTTGGCGAAAAGGATGTTGAGTGCACTGCCACCATCGATGAGGGATCTGC

Reverse complement sequence

GCAGATCCCTCATCGATGGTGGCAGTGCACTCAACATCCTTTTCGCCAAGACTCTGGACGACATGCAGATCCCTCGCACGGAATTAAAGCCGAGTAATGT[G/A]
CCCTTTCACGGAGTCATCCCAGGGCTATCTACTACACCACTCGGCCAGATCATTCTTCCGGTTACTTTCGGCACTCGGGAGAACTTCCGCACAGAGAACA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.50% 17.30% 0.13% 0.00% NA
All Indica  2759 75.50% 24.20% 0.22% 0.00% NA
All Japonica  1512 99.50% 0.50% 0.00% 0.00% NA
Aus  269 79.60% 20.40% 0.00% 0.00% NA
Indica I  595 70.40% 29.60% 0.00% 0.00% NA
Indica II  465 92.30% 7.70% 0.00% 0.00% NA
Indica III  913 69.30% 30.30% 0.33% 0.00% NA
Indica Intermediate  786 76.70% 22.90% 0.38% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 22.90% 77.10% 0.00% 0.00% NA
Intermediate  90 85.60% 14.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0217842911 C -> T LOC_Os02g30040.1 synonymous_variant ; p.Val757Val; LOW nonsynonymous_codon ; V757A Average:77.829; most accessible tissue: Minghui63 flag leaf, score: 93.756 possibly damaging -1.7 TOLERATED 1.00

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0217842911 C T 0.0 0.0 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0217842911 NA 3.15E-06 mr1236 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217842911 NA 1.13E-06 mr1251 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217842911 7.46E-06 2.92E-06 mr1253 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217842911 8.88E-06 7.44E-08 mr1255 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217842911 NA 7.87E-08 mr1257 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217842911 NA 3.59E-06 mr1423 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217842911 NA 1.13E-06 mr1435 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217842911 2.09E-06 8.38E-07 mr1102_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217842911 NA 9.78E-07 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217842911 NA 6.02E-08 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217842911 NA 2.44E-07 mr1255_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217842911 NA 2.55E-07 mr1257_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217842911 NA 2.20E-07 mr1379_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217842911 NA 5.51E-07 mr1559_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217842911 7.83E-06 NA mr1927_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251