\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0217836354:

Variant ID: vg0217836354 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 17836354
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


TATTCTCCCATTTCTTTTACGGCGGGTTTTCTCTTCCAACCTCAAACTTCTTCTGAGGAATTCTGGATTTCTATGGTATTAACCTGCATCACCTAAATCC[C/T]
AATTCCATAGTCCACATTGCCAACTTCATCCACGCTTGCGAAGCTTTTCTAGGGATTAGGCCGCATTTCGCTCTATTCCGCCGCATCTTCTTTCTCAAGC

Reverse complement sequence

GCTTGAGAAAGAAGATGCGGCGGAATAGAGCGAAATGCGGCCTAATCCCTAGAAAAGCTTCGCAAGCGTGGATGAAGTTGGCAATGTGGACTATGGAATT[G/A]
GGATTTAGGTGATGCAGGTTAATACCATAGAAATCCAGAATTCCTCAGAAGAAGTTTGAGGTTGGAAGAGAAAACCCGCCGTAAAAGAAATGGGAGAATA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.10% 28.50% 0.19% 0.25% NA
All Indica  2759 77.30% 22.20% 0.25% 0.29% NA
All Japonica  1512 53.20% 46.60% 0.07% 0.13% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 83.40% 16.10% 0.22% 0.22% NA
Indica III  913 54.50% 44.90% 0.22% 0.33% NA
Indica Intermediate  786 83.00% 16.00% 0.51% 0.51% NA
Temperate Japonica  767 94.90% 5.10% 0.00% 0.00% NA
Tropical Japonica  504 3.20% 96.60% 0.00% 0.20% NA
Japonica Intermediate  241 24.90% 74.30% 0.41% 0.41% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 71.10% 25.60% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0217836354 C -> T LOC_Os02g30010.1 upstream_gene_variant ; 3963.0bp to feature; MODIFIER silent_mutation Average:44.635; most accessible tissue: Minghui63 flag leaf, score: 68.675 N N N N
vg0217836354 C -> T LOC_Os02g30030.1 downstream_gene_variant ; 3582.0bp to feature; MODIFIER silent_mutation Average:44.635; most accessible tissue: Minghui63 flag leaf, score: 68.675 N N N N
vg0217836354 C -> T LOC_Os02g30020.1 intron_variant ; MODIFIER silent_mutation Average:44.635; most accessible tissue: Minghui63 flag leaf, score: 68.675 N N N N
vg0217836354 C -> DEL N N silent_mutation Average:44.635; most accessible tissue: Minghui63 flag leaf, score: 68.675 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0217836354 NA 1.47E-09 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0217836354 NA 1.65E-11 mr1138 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217836354 NA 3.49E-06 mr1138 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217836354 NA 8.74E-06 mr1169 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217836354 NA 3.21E-09 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217836354 NA 2.71E-10 mr1563 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217836354 NA 1.55E-06 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217836354 NA 1.89E-07 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217836354 NA 3.66E-06 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217836354 NA 1.66E-09 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217836354 5.27E-07 6.44E-15 mr1138_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217836354 NA 6.28E-09 mr1138_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217836354 NA 6.08E-06 mr1138_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217836354 NA 2.87E-08 mr1156_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217836354 NA 2.83E-07 mr1338_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217836354 NA 7.61E-08 mr1350_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217836354 NA 2.02E-15 mr1354_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217836354 NA 1.30E-06 mr1354_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217836354 NA 3.92E-06 mr1582_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217836354 NA 8.10E-10 mr1864_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217836354 NA 5.36E-08 mr1952_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251