\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0217819624:

Variant ID: vg0217819624 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 17819624
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.53, G: 0.49, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


GAAATCATATCTGCATCCATTTCAATTTTTTAATCCCACTTCTCATAATTCATGTCGAAACAAGATTTCGGCAATACTAAAAGGGGTGGCTATCAAGCTG[A/G]
AAAAGTGGATGGGTTAAGAGACAAGGAATTTTATACAAGTTCAGGCCTTCTTAATCAAGAAGTAATACCCTACTCCTGTCCGGAGATTGATCCGCCGAGT

Reverse complement sequence

ACTCGGCGGATCAATCTCCGGACAGGAGTAGGGTATTACTTCTTGATTAAGAAGGCCTGAACTTGTATAAAATTCCTTGTCTCTTAACCCATCCACTTTT[T/C]
CAGCTTGATAGCCACCCCTTTTAGTATTGCCGAAATCTTGTTTCGACATGAATTATGAGAAGTGGGATTAAAAAATTGAAATGGATGCAGATATGATTTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.50% 32.40% 0.08% 0.02% NA
All Indica  2759 75.50% 24.30% 0.14% 0.04% NA
All Japonica  1512 48.60% 51.40% 0.00% 0.00% NA
Aus  269 79.90% 20.10% 0.00% 0.00% NA
Indica I  595 70.40% 29.60% 0.00% 0.00% NA
Indica II  465 90.80% 9.20% 0.00% 0.00% NA
Indica III  913 70.00% 29.80% 0.11% 0.11% NA
Indica Intermediate  786 76.70% 22.90% 0.38% 0.00% NA
Temperate Japonica  767 6.40% 93.60% 0.00% 0.00% NA
Tropical Japonica  504 98.60% 1.40% 0.00% 0.00% NA
Japonica Intermediate  241 78.40% 21.60% 0.00% 0.00% NA
VI/Aromatic  96 89.60% 10.40% 0.00% 0.00% NA
Intermediate  90 77.80% 22.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0217819624 A -> G LOC_Os02g29990.1 upstream_gene_variant ; 3233.0bp to feature; MODIFIER silent_mutation Average:55.484; most accessible tissue: Zhenshan97 flag leaf, score: 81.008 N N N N
vg0217819624 A -> G LOC_Os02g29980.1 downstream_gene_variant ; 450.0bp to feature; MODIFIER silent_mutation Average:55.484; most accessible tissue: Zhenshan97 flag leaf, score: 81.008 N N N N
vg0217819624 A -> G LOC_Os02g30000.1 downstream_gene_variant ; 4525.0bp to feature; MODIFIER silent_mutation Average:55.484; most accessible tissue: Zhenshan97 flag leaf, score: 81.008 N N N N
vg0217819624 A -> G LOC_Os02g29980-LOC_Os02g29990 intergenic_region ; MODIFIER silent_mutation Average:55.484; most accessible tissue: Zhenshan97 flag leaf, score: 81.008 N N N N
vg0217819624 A -> DEL N N silent_mutation Average:55.484; most accessible tissue: Zhenshan97 flag leaf, score: 81.008 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0217819624 NA 1.38E-06 mr1109 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217819624 NA 7.17E-06 mr1236 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217819624 4.69E-06 4.69E-06 mr1248 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217819624 1.82E-06 NA mr1251 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217819624 NA 2.34E-07 mr1251 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217819624 5.43E-08 NA mr1253 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217819624 6.42E-07 3.02E-07 mr1253 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217819624 4.69E-06 NA mr1255 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217819624 7.27E-06 1.29E-07 mr1255 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217819624 1.50E-06 NA mr1257 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217819624 7.00E-06 1.25E-08 mr1257 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217819624 NA 2.86E-06 mr1368 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217819624 4.63E-06 NA mr1423 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217819624 2.72E-06 7.90E-08 mr1423 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217819624 4.62E-06 NA mr1435 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217819624 NA 1.44E-07 mr1435 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217819624 NA 1.11E-09 mr1563 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217819624 NA 7.60E-08 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217819624 NA 2.68E-09 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217819624 NA 5.56E-08 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217819624 NA 5.99E-06 mr1102_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217819624 1.36E-06 NA mr1109_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217819624 6.85E-06 NA mr1109_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217819624 NA 5.08E-07 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217819624 NA 4.66E-08 mr1156_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217819624 NA 4.73E-08 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217819624 NA 3.21E-07 mr1255_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217819624 NA 3.22E-07 mr1257_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217819624 NA 7.06E-08 mr1350_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217819624 NA 9.13E-11 mr1368_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217819624 NA 2.40E-07 mr1379_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217819624 NA 5.90E-06 mr1423_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217819624 NA 1.87E-07 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217819624 NA 1.65E-09 mr1864_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251