\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0217805111:

Variant ID: vg0217805111 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 17805111
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


TTGTAATACTTTCTCCACTCCATTTCATATTATAAGATATCTTTATTTTTTTAAGTCTATTTTTTAAGTTTAATATATTTATATAGAAATATAGCAATAT[C/A]
TGTAACACCAAAATAGTATCACTAAATATAATTTTGAGAATATTTTATATTGTATTTGTTTTATATTAAAAATGTTGTTACGTTTTCATACAAACTTGAT

Reverse complement sequence

ATCAAGTTTGTATGAAAACGTAACAACATTTTTAATATAAAACAAATACAATATAAAATATTCTCAAAATTATATTTAGTGATACTATTTTGGTGTTACA[G/T]
ATATTGCTATATTTCTATATAAATATATTAAACTTAAAAAATAGACTTAAAAAAATAAAGATATCTTATAATATGAAATGGAGTGGAGAAAGTATTACAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.20% 15.00% 2.22% 0.57% NA
All Indica  2759 79.90% 19.70% 0.40% 0.00% NA
All Japonica  1512 91.80% 0.40% 6.02% 1.79% NA
Aus  269 75.10% 24.90% 0.00% 0.00% NA
Indica I  595 84.90% 15.00% 0.17% 0.00% NA
Indica II  465 90.80% 8.80% 0.43% 0.00% NA
Indica III  913 69.70% 30.20% 0.11% 0.00% NA
Indica Intermediate  786 81.70% 17.40% 0.89% 0.00% NA
Temperate Japonica  767 86.00% 0.00% 10.56% 3.39% NA
Tropical Japonica  504 99.40% 0.40% 0.20% 0.00% NA
Japonica Intermediate  241 94.20% 1.70% 3.73% 0.41% NA
VI/Aromatic  96 18.80% 80.20% 1.04% 0.00% NA
Intermediate  90 81.10% 16.70% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0217805111 C -> A LOC_Os02g29960.1 upstream_gene_variant ; 377.0bp to feature; MODIFIER silent_mutation Average:62.045; most accessible tissue: Zhenshan97 flag leaf, score: 79.935 N N N N
vg0217805111 C -> A LOC_Os02g29950.1 downstream_gene_variant ; 2681.0bp to feature; MODIFIER silent_mutation Average:62.045; most accessible tissue: Zhenshan97 flag leaf, score: 79.935 N N N N
vg0217805111 C -> A LOC_Os02g29970.1 downstream_gene_variant ; 4956.0bp to feature; MODIFIER silent_mutation Average:62.045; most accessible tissue: Zhenshan97 flag leaf, score: 79.935 N N N N
vg0217805111 C -> A LOC_Os02g29950-LOC_Os02g29960 intergenic_region ; MODIFIER silent_mutation Average:62.045; most accessible tissue: Zhenshan97 flag leaf, score: 79.935 N N N N
vg0217805111 C -> DEL N N silent_mutation Average:62.045; most accessible tissue: Zhenshan97 flag leaf, score: 79.935 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0217805111 NA 1.14E-07 mr1380_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217805111 NA 2.69E-07 mr1561_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217805111 2.91E-06 NA mr1610_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217805111 NA 2.94E-07 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217805111 NA 5.38E-07 mr1908_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217805111 NA 2.39E-06 mr1996_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251