\
| Variant ID: vg0217805111 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 17805111 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 113. )
TTGTAATACTTTCTCCACTCCATTTCATATTATAAGATATCTTTATTTTTTTAAGTCTATTTTTTAAGTTTAATATATTTATATAGAAATATAGCAATAT[C/A]
TGTAACACCAAAATAGTATCACTAAATATAATTTTGAGAATATTTTATATTGTATTTGTTTTATATTAAAAATGTTGTTACGTTTTCATACAAACTTGAT
ATCAAGTTTGTATGAAAACGTAACAACATTTTTAATATAAAACAAATACAATATAAAATATTCTCAAAATTATATTTAGTGATACTATTTTGGTGTTACA[G/T]
ATATTGCTATATTTCTATATAAATATATTAAACTTAAAAAATAGACTTAAAAAAATAAAGATATCTTATAATATGAAATGGAGTGGAGAAAGTATTACAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.20% | 15.00% | 2.22% | 0.57% | NA |
| All Indica | 2759 | 79.90% | 19.70% | 0.40% | 0.00% | NA |
| All Japonica | 1512 | 91.80% | 0.40% | 6.02% | 1.79% | NA |
| Aus | 269 | 75.10% | 24.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 84.90% | 15.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 90.80% | 8.80% | 0.43% | 0.00% | NA |
| Indica III | 913 | 69.70% | 30.20% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 81.70% | 17.40% | 0.89% | 0.00% | NA |
| Temperate Japonica | 767 | 86.00% | 0.00% | 10.56% | 3.39% | NA |
| Tropical Japonica | 504 | 99.40% | 0.40% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 94.20% | 1.70% | 3.73% | 0.41% | NA |
| VI/Aromatic | 96 | 18.80% | 80.20% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 81.10% | 16.70% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0217805111 | C -> A | LOC_Os02g29960.1 | upstream_gene_variant ; 377.0bp to feature; MODIFIER | silent_mutation | Average:62.045; most accessible tissue: Zhenshan97 flag leaf, score: 79.935 | N | N | N | N |
| vg0217805111 | C -> A | LOC_Os02g29950.1 | downstream_gene_variant ; 2681.0bp to feature; MODIFIER | silent_mutation | Average:62.045; most accessible tissue: Zhenshan97 flag leaf, score: 79.935 | N | N | N | N |
| vg0217805111 | C -> A | LOC_Os02g29970.1 | downstream_gene_variant ; 4956.0bp to feature; MODIFIER | silent_mutation | Average:62.045; most accessible tissue: Zhenshan97 flag leaf, score: 79.935 | N | N | N | N |
| vg0217805111 | C -> A | LOC_Os02g29950-LOC_Os02g29960 | intergenic_region ; MODIFIER | silent_mutation | Average:62.045; most accessible tissue: Zhenshan97 flag leaf, score: 79.935 | N | N | N | N |
| vg0217805111 | C -> DEL | N | N | silent_mutation | Average:62.045; most accessible tissue: Zhenshan97 flag leaf, score: 79.935 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0217805111 | NA | 1.14E-07 | mr1380_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217805111 | NA | 2.69E-07 | mr1561_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217805111 | 2.91E-06 | NA | mr1610_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217805111 | NA | 2.94E-07 | mr1653_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217805111 | NA | 5.38E-07 | mr1908_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217805111 | NA | 2.39E-06 | mr1996_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |