\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0217797694:

Variant ID: vg0217797694 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 17797694
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGTATTAGAGGATCTTAGCATGAATTTTGCTGCAGTGGATGTTCTTTTCTTTATGGATAAGAACAGATTATCTACACTTGTTGATTTATATACCCTTGTT[A/G]
TCTATGAATAGGTGAATTGCATGAATTATTGTTTATATACATGATTTATATACCCTTGCTGTCTATGAATAGGTGATTTGCATGAATTGTTGTTTATATA

Reverse complement sequence

TATATAAACAACAATTCATGCAAATCACCTATTCATAGACAGCAAGGGTATATAAATCATGTATATAAACAATAATTCATGCAATTCACCTATTCATAGA[T/C]
AACAAGGGTATATAAATCAACAAGTGTAGATAATCTGTTCTTATCCATAAAGAAAAGAACATCCACTGCAGCAAAATTCATGCTAAGATCCTCTAATACC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.00% 0.80% 3.13% 56.09% NA
All Indica  2759 11.90% 1.00% 4.35% 82.78% NA
All Japonica  1512 98.50% 0.10% 0.00% 1.39% NA
Aus  269 3.70% 1.50% 9.67% 85.13% NA
Indica I  595 6.60% 0.30% 1.68% 91.43% NA
Indica II  465 16.30% 1.10% 4.09% 78.49% NA
Indica III  913 13.80% 1.50% 6.35% 78.31% NA
Indica Intermediate  786 11.10% 0.80% 4.20% 83.97% NA
Temperate Japonica  767 99.00% 0.00% 0.00% 1.04% NA
Tropical Japonica  504 98.20% 0.20% 0.00% 1.59% NA
Japonica Intermediate  241 97.50% 0.40% 0.00% 2.07% NA
VI/Aromatic  96 16.70% 3.10% 2.08% 78.12% NA
Intermediate  90 53.30% 0.00% 0.00% 46.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0217797694 A -> G LOC_Os02g29940.1 upstream_gene_variant ; 249.0bp to feature; MODIFIER silent_mutation Average:19.73; most accessible tissue: Minghui63 young leaf, score: 29.964 N N N N
vg0217797694 A -> G LOC_Os02g29950.1 upstream_gene_variant ; 1255.0bp to feature; MODIFIER silent_mutation Average:19.73; most accessible tissue: Minghui63 young leaf, score: 29.964 N N N N
vg0217797694 A -> G LOC_Os02g29920.1 downstream_gene_variant ; 3358.0bp to feature; MODIFIER silent_mutation Average:19.73; most accessible tissue: Minghui63 young leaf, score: 29.964 N N N N
vg0217797694 A -> G LOC_Os02g29930.1 downstream_gene_variant ; 1444.0bp to feature; MODIFIER silent_mutation Average:19.73; most accessible tissue: Minghui63 young leaf, score: 29.964 N N N N
vg0217797694 A -> G LOC_Os02g29940-LOC_Os02g29950 intergenic_region ; MODIFIER silent_mutation Average:19.73; most accessible tissue: Minghui63 young leaf, score: 29.964 N N N N
vg0217797694 A -> DEL N N silent_mutation Average:19.73; most accessible tissue: Minghui63 young leaf, score: 29.964 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0217797694 1.14E-06 9.68E-06 mr1057 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217797694 NA 1.81E-07 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217797694 8.44E-07 1.75E-41 mr1089 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217797694 4.38E-09 2.34E-11 mr1089 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217797694 NA 2.93E-41 mr1093 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217797694 3.86E-07 2.13E-11 mr1093 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217797694 9.71E-06 NA mr1129 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217797694 5.20E-08 5.20E-08 mr1159 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217797694 NA 8.29E-06 mr1235 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217797694 NA 1.55E-31 mr1243 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217797694 NA 1.32E-17 mr1253 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217797694 NA 4.50E-06 mr1257 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217797694 NA 2.26E-30 mr1423 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217797694 NA 4.07E-07 mr1423 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217797694 NA 4.41E-06 mr1435 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217797694 NA 1.00E-49 mr1599 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217797694 NA 9.25E-08 mr1599 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217797694 NA 3.26E-09 mr1089_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217797694 NA 3.42E-09 mr1093_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217797694 NA 8.82E-08 mr1235_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217797694 NA 1.94E-39 mr1243_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217797694 NA 3.66E-06 mr1243_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217797694 NA 8.11E-37 mr1251_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217797694 NA 3.98E-07 mr1251_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217797694 NA 3.67E-20 mr1255_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217797694 NA 1.90E-35 mr1257_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217797694 NA 3.38E-29 mr1423_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217797694 NA 1.18E-36 mr1435_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217797694 NA 6.11E-07 mr1435_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217797694 NA 3.22E-59 mr1599_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217797694 NA 1.71E-08 mr1599_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217797694 NA 6.69E-07 mr1691_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217797694 NA 1.49E-06 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251