\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0217787880:

Variant ID: vg0217787880 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 17787880
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGGGAAAGATCGTTTATGTGAGATTTTTTTTTGAAATAATACGATTTTAATGGAAAATCGCAAAAATATAAGTCGGTTAGGCGAAATTGCAAGTTTAGCA[C/T]
CCTATCGAACATCCGTGGTTCGACAGGGTACCTATTGAACAACCGCAGTTCAACAGGGTACCTATCGAGAGTTCGACAGGTGATAAAATAATTTTATAAA

Reverse complement sequence

TTTATAAAATTATTTTATCACCTGTCGAACTCTCGATAGGTACCCTGTTGAACTGCGGTTGTTCAATAGGTACCCTGTCGAACCACGGATGTTCGATAGG[G/A]
TGCTAAACTTGCAATTTCGCCTAACCGACTTATATTTTTGCGATTTTCCATTAAAATCGTATTATTTCAAAAAAAAATCTCACATAAACGATCTTTCCCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.30% 0.50% 0.40% 61.79% NA
All Indica  2759 7.80% 0.70% 0.54% 90.94% NA
All Japonica  1512 98.30% 0.00% 0.07% 1.65% NA
Aus  269 1.50% 0.00% 0.37% 98.14% NA
Indica I  595 2.50% 0.00% 0.67% 96.81% NA
Indica II  465 12.30% 0.40% 0.65% 86.67% NA
Indica III  913 9.60% 1.50% 0.44% 88.39% NA
Indica Intermediate  786 7.00% 0.50% 0.51% 91.98% NA
Temperate Japonica  767 98.70% 0.00% 0.00% 1.30% NA
Tropical Japonica  504 98.20% 0.00% 0.00% 1.79% NA
Japonica Intermediate  241 97.10% 0.00% 0.41% 2.49% NA
VI/Aromatic  96 16.70% 1.00% 2.08% 80.21% NA
Intermediate  90 48.90% 1.10% 0.00% 50.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0217787880 C -> T LOC_Os02g29920.1 upstream_gene_variant ; 4691.0bp to feature; MODIFIER silent_mutation Average:54.287; most accessible tissue: Callus, score: 75.249 N N N N
vg0217787880 C -> T LOC_Os02g29890.1 downstream_gene_variant ; 2331.0bp to feature; MODIFIER silent_mutation Average:54.287; most accessible tissue: Callus, score: 75.249 N N N N
vg0217787880 C -> T LOC_Os02g29900.1 downstream_gene_variant ; 1296.0bp to feature; MODIFIER silent_mutation Average:54.287; most accessible tissue: Callus, score: 75.249 N N N N
vg0217787880 C -> T LOC_Os02g29910.1 downstream_gene_variant ; 3310.0bp to feature; MODIFIER silent_mutation Average:54.287; most accessible tissue: Callus, score: 75.249 N N N N
vg0217787880 C -> T LOC_Os02g29890-LOC_Os02g29900 intergenic_region ; MODIFIER silent_mutation Average:54.287; most accessible tissue: Callus, score: 75.249 N N N N
vg0217787880 C -> DEL N N silent_mutation Average:54.287; most accessible tissue: Callus, score: 75.249 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0217787880 NA 2.27E-06 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217787880 9.59E-06 5.20E-42 mr1089 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217787880 NA 2.01E-08 mr1089 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217787880 1.46E-06 4.02E-46 mr1093 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217787880 2.01E-07 7.48E-14 mr1093 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217787880 NA 2.28E-34 mr1105 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217787880 NA 1.71E-06 mr1109 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217787880 2.38E-06 NA mr1129 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217787880 NA 3.45E-07 mr1129 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217787880 6.42E-06 1.50E-43 mr1235 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217787880 NA 2.56E-09 mr1235 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217787880 NA 1.00E-38 mr1243 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217787880 NA 1.11E-07 mr1243 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217787880 NA 1.98E-24 mr1251 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217787880 NA 9.06E-18 mr1253 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217787880 NA 1.22E-06 mr1257 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217787880 NA 3.76E-35 mr1350 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217787880 NA 1.23E-32 mr1423 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217787880 NA 3.29E-08 mr1423 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217787880 NA 9.15E-38 mr1435 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217787880 NA 4.23E-07 mr1435 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217787880 NA 7.80E-39 mr1480 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217787880 NA 1.24E-31 mr1546 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217787880 3.20E-06 6.00E-57 mr1599 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217787880 9.02E-06 1.85E-10 mr1599 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217787880 3.61E-06 1.29E-09 mr1064_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217787880 NA 9.29E-53 mr1089_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217787880 NA 1.49E-08 mr1089_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217787880 NA 3.44E-55 mr1093_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217787880 NA 2.27E-10 mr1093_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217787880 NA 1.22E-59 mr1235_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217787880 NA 1.67E-09 mr1235_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217787880 NA 1.71E-44 mr1243_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217787880 NA 6.58E-06 mr1243_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217787880 NA 1.81E-12 mr1248_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217787880 NA 1.13E-39 mr1251_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217787880 NA 1.29E-19 mr1255_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217787880 NA 1.52E-37 mr1257_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217787880 NA 4.36E-12 mr1377_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217787880 NA 6.36E-09 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217787880 NA 4.16E-31 mr1423_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217787880 NA 1.41E-39 mr1435_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217787880 NA 4.79E-69 mr1599_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217787880 NA 1.68E-09 mr1599_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217787880 NA 5.49E-19 mr1637_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217787880 NA 1.20E-06 mr1691_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0217787880 NA 1.57E-33 mr1780_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251